ID: 1072283779

View in Genome Browser
Species Human (GRCh38)
Location 10:93894105-93894127
Sequence CCCGGGCGCCACTGAGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072283771_1072283779 5 Left 1072283771 10:93894077-93894099 CCGGGCTGCCGCTAACGGACGAT 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG 0: 1
1: 0
2: 3
3: 14
4: 232
1072283765_1072283779 29 Left 1072283765 10:93894053-93894075 CCGGGGTCGCGGAGCTCCAGGAG 0: 1
1: 0
2: 0
3: 23
4: 187
Right 1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG 0: 1
1: 0
2: 3
3: 14
4: 232
1072283770_1072283779 6 Left 1072283770 10:93894076-93894098 CCCGGGCTGCCGCTAACGGACGA 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG 0: 1
1: 0
2: 3
3: 14
4: 232
1072283768_1072283779 13 Left 1072283768 10:93894069-93894091 CCAGGAGCCCGGGCTGCCGCTAA 0: 1
1: 1
2: 1
3: 10
4: 117
Right 1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG 0: 1
1: 0
2: 3
3: 14
4: 232
1072283772_1072283779 -3 Left 1072283772 10:93894085-93894107 CCGCTAACGGACGATGCACCCCC 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG 0: 1
1: 0
2: 3
3: 14
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072283779 Original CRISPR CCCGGGCGCCACTGAGGAGC CGG Exonic
900255643 1:1697201-1697223 CCCGGGAGCCACAGAGGAGCCGG - Intronic
900264313 1:1749824-1749846 CCCGGGAGCCACAGAGGAGCTGG - Intergenic
900590871 1:3459257-3459279 CCCTGGCCCCACTGAGGGTCTGG - Intronic
900658524 1:3772024-3772046 CCCCGGCGCCTCTGAGGCTCTGG + Intergenic
904307409 1:29599082-29599104 CCCGGGCACCCCTGGGCAGCAGG + Intergenic
904396332 1:30224865-30224887 CCCGGGCACCCCTGGGCAGCAGG - Intergenic
904738628 1:32654258-32654280 CTCAGCCCCCACTGAGGAGCTGG - Intronic
910929215 1:92425894-92425916 CCCAGCTGCCACTGAGGAGCAGG + Intergenic
914954923 1:152153235-152153257 CTGGGGAGCCACTGAGGAGAAGG + Intergenic
919617356 1:199824176-199824198 GCTGGGTGCCACTGAGGACCAGG + Intergenic
920961935 1:210671305-210671327 CCCTGAACCCACTGAGGAGCAGG + Intronic
921249439 1:213282446-213282468 AGCAGGCGCCTCTGAGGAGCAGG - Intergenic
922526709 1:226309441-226309463 CCCGGGCGGGACTCCGGAGCTGG - Exonic
924613031 1:245589413-245589435 CCCAGGCGGCACTGAGAAGGGGG + Intronic
924862954 1:247945265-247945287 CCCAGGAGTCACTCAGGAGCAGG + Intronic
1063687143 10:8247515-8247537 CCTGGGGGCCACTGAGAGGCTGG + Intergenic
1066050858 10:31633436-31633458 CCCTGGCACTGCTGAGGAGCAGG + Intergenic
1067830811 10:49610226-49610248 CCCGGGCACCACTCGGGGGCTGG + Intronic
1068835866 10:61552912-61552934 CCCAGGAGTCACTCAGGAGCAGG - Intergenic
1069937784 10:71930458-71930480 CTCGGTCCCCACTGAGTAGCTGG - Intergenic
1070079143 10:73168296-73168318 CCCGGCCGCGGCTGAGGAGGAGG + Exonic
1071076961 10:81766459-81766481 CCCGGGAGTCATTCAGGAGCAGG + Intergenic
1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG + Exonic
1073287763 10:102398837-102398859 GCCGGGGGCTACGGAGGAGCTGG + Exonic
1073535786 10:104275369-104275391 CCCGGGCTCCTGTGAGGCGCTGG - Intronic
1073812245 10:107164278-107164300 CCCGGGGGCCACTGAGAACAGGG + Exonic
1075401644 10:122164978-122165000 CCTGGGCTTCAGTGAGGAGCTGG + Intronic
1075796482 10:125123673-125123695 CCCCGGGGCCCCTGGGGAGCCGG - Intronic
1076491221 10:130862849-130862871 CCCAGGCGCCACTAGTGAGCTGG + Intergenic
1078896903 11:15604866-15604888 CCCTGGTGCCACTGAGGTGAGGG + Intergenic
1078996127 11:16701739-16701761 CCCGCCCGCCCCTGAGTAGCTGG - Intronic
1081713357 11:45232236-45232258 CCCAGCCGGCACTGAGGGGCTGG + Intronic
1083207526 11:61161500-61161522 CACGCGCGCCACTGGGGCGCCGG - Exonic
1083735523 11:64678061-64678083 CCAGGGAGTCACTGAGGAGAGGG + Intronic
1083851512 11:65370355-65370377 CTGGGAAGCCACTGAGGAGCAGG + Intergenic
1085909153 11:80800683-80800705 CCCGGGAGTCATTCAGGAGCAGG - Intergenic
1087682295 11:101231365-101231387 ACCGGGCGCCACAGAGCAGGGGG + Intergenic
1089325916 11:117656854-117656876 CCCAGGCACCCCTGAGGAACTGG + Intronic
1090658181 11:128861598-128861620 CCTGGGAGCCACTGCAGAGCGGG + Intronic
1092604707 12:10105748-10105770 CCCAGGAGCCATTCAGGAGCAGG - Intronic
1094333860 12:29325633-29325655 CCCAGTAGTCACTGAGGAGCAGG - Intronic
1096585862 12:52619140-52619162 CCCGGCTGGCACAGAGGAGCAGG - Intergenic
1096611652 12:52805925-52805947 CCCAGGCACCCCTGAGGAGCTGG + Intergenic
1097088656 12:56488133-56488155 CCCGGGCGCACCTGCAGAGCCGG - Exonic
1097749225 12:63333461-63333483 CCCAGGAGTCACTCAGGAGCAGG - Intergenic
1098201560 12:68061744-68061766 CCCAGGAGCCATTCAGGAGCAGG + Intergenic
1099502405 12:83430267-83430289 CCCAGGAGTCATTGAGGAGCAGG + Intergenic
1103724498 12:122991005-122991027 CCCTGGAGCCACTGGGGTGCTGG - Intronic
1103903681 12:124316427-124316449 CCTGGCTGCCACTGCGGAGCAGG + Intergenic
1107412690 13:40172455-40172477 CTCGGGCGGCTCTGAGGTGCAGG - Intergenic
1111908149 13:94279700-94279722 CCCAGGAGTCACTCAGGAGCAGG + Intronic
1116685443 14:48033371-48033393 CCCAGGAGTCACTCAGGAGCAGG + Intergenic
1122265515 14:100544907-100544929 CCCCTGGGCCACTCAGGAGCTGG - Intronic
1122301029 14:100731202-100731224 TCCTGGCCCCACTGGGGAGCTGG + Intronic
1122855136 14:104556476-104556498 CTAGGGGGCCACTCAGGAGCAGG + Intronic
1123061835 14:105598007-105598029 CCCCGCTGCCACTGTGGAGCCGG - Intergenic
1123086573 14:105719738-105719760 CCCCGCTGCCACTGTGGAGCCGG - Intergenic
1127100193 15:55556383-55556405 CCCGGGAGTCATTCAGGAGCAGG - Intronic
1127687416 15:61362376-61362398 CCCAGGAGTCACTCAGGAGCAGG + Intergenic
1128152607 15:65372662-65372684 CCCACGGGCCCCTGAGGAGCAGG + Intronic
1129226099 15:74171298-74171320 CCTGGGCTCTGCTGAGGAGCAGG + Intergenic
1129227568 15:74178973-74178995 CCCTGGGTCCACTGAGGGGCTGG - Intergenic
1129453428 15:75663360-75663382 AGCCAGCGCCACTGAGGAGCAGG + Intergenic
1129799816 15:78405615-78405637 CCCGGCCGCCCCTGAGCACCCGG + Intergenic
1130577407 15:85104868-85104890 CCAGGGGAGCACTGAGGAGCAGG + Intronic
1133008861 16:2899115-2899137 GCCGGGCGCCACAGAGCAGGGGG - Exonic
1133272031 16:4614977-4614999 GCCGGGCGCCCCGGGGGAGCGGG + Intronic
1134644944 16:15858316-15858338 CCCGGGAACCTCGGAGGAGCTGG - Intergenic
1139954397 16:70686266-70686288 CGCGGGCGCCACCGAGGGTCGGG + Intergenic
1140477218 16:75245083-75245105 CCAGAGCCCCACAGAGGAGCGGG + Intronic
1140692366 16:77496801-77496823 CCCTCGCTCCACTTAGGAGCTGG - Intergenic
1141415301 16:83866991-83867013 CCCGGGAGTCATTCAGGAGCAGG + Intergenic
1141638512 16:85328353-85328375 CCCCGACGCCTCTGAGGAGGTGG - Intergenic
1141669814 16:85485831-85485853 CCCGGGCCCCAGGTAGGAGCTGG + Intergenic
1141675614 16:85515763-85515785 GCTGGGGGCCACTGAAGAGCAGG - Intergenic
1141694166 16:85612105-85612127 CCCGGGCGGCTCTGAGGCCCCGG - Intronic
1143902305 17:10183511-10183533 CCAGGGCTCCTCTGAGGATCAGG - Intronic
1148353495 17:46958144-46958166 CCAGGGGGCCTCAGAGGAGCTGG + Intronic
1149578341 17:57729543-57729565 CCCTGGCACTACTGAGCAGCAGG + Intergenic
1149867105 17:60157133-60157155 CCAGGGCACCACAGAGGAGGTGG + Intronic
1150135619 17:62693298-62693320 CCTGGGGGCCCCAGAGGAGCAGG + Exonic
1151472558 17:74327019-74327041 CCCAGGCACCACTGATGATCAGG - Intronic
1152684258 17:81686399-81686421 CCTGGGGGCCACTGAGGCACGGG - Intronic
1154169242 18:12038694-12038716 CCCGGGCTGGACTGAGGGGCTGG + Intergenic
1154371287 18:13765417-13765439 CCCAGGAGCCACTGGGGACCAGG - Intergenic
1156664907 18:39392966-39392988 CCCAGGAGCCATTCAGGAGCAGG - Intergenic
1156695130 18:39756513-39756535 CCCAGGAGTCACTCAGGAGCAGG - Intergenic
1157486735 18:48093014-48093036 CCCGGGGGCCAGTCAGGACCAGG + Intronic
1159274211 18:66194170-66194192 CCCGGGAGCCACTCAGGAACAGG + Intergenic
1159922508 18:74238368-74238390 CCCAGGACACACTGAGGAGCCGG + Intergenic
1160926924 19:1550902-1550924 CACGGGGGACACTGAGGGGCAGG - Intergenic
1161738844 19:6008010-6008032 CCCGGGTGACGCTGAGGAGCTGG - Intronic
1162869526 19:13575115-13575137 GCCGGCCGCCTCTCAGGAGCTGG + Intronic
1163116555 19:15192222-15192244 ATCGGGCCCCACTGAGCAGCGGG + Exonic
1163774228 19:19208452-19208474 CCCTGGCACCAGCGAGGAGCCGG + Intergenic
1163862837 19:19751142-19751164 TCAGGGAGCCACTGAGGACCAGG - Intergenic
1165384397 19:35501962-35501984 GCCGTGAGTCACTGAGGAGCAGG - Intronic
1166094571 19:40530784-40530806 CGCGGGCGGGACTGAGGGGCCGG + Intronic
1166198720 19:41222562-41222584 CCCGGTCCCCACTGGGGAGATGG + Intronic
1166858549 19:45795913-45795935 CCTGGGAGCCACAGAGGAGGAGG - Exonic
1168649650 19:58085242-58085264 GTCGGGCACCACTGAGGAGGAGG - Exonic
924962498 2:46681-46703 CCCGGGCGGGAGTGAGGAGGCGG - Intronic
925029208 2:636499-636521 CACCGGCCCCTCTGAGGAGCAGG + Intergenic
926302216 2:11612631-11612653 CCTGGGGGTCTCTGAGGAGCTGG + Intronic
927849351 2:26489256-26489278 CCAGGGTGCCACTGCGCAGCAGG + Exonic
928269605 2:29844323-29844345 CCCCGGGGCCAGTGGGGAGCAGG + Intronic
928436423 2:31257406-31257428 CCCGGGCTCCAGTGAGGAGCTGG + Intronic
929073305 2:38056150-38056172 CCCGGGATCCAGTGGGGAGCAGG + Intronic
930798723 2:55420153-55420175 CCTGGGCGCAACCGAGGAGCGGG - Intergenic
933436290 2:82254438-82254460 CCCAGGCGTCATTCAGGAGCAGG + Intergenic
937083900 2:119158341-119158363 CCCGGGCGGCAAGGAGGAGCTGG - Exonic
937610787 2:123858333-123858355 CCCGGGAGTCATTCAGGAGCAGG - Intergenic
937839099 2:126507701-126507723 CCAGGCAGCCACTGTGGAGCAGG - Intergenic
939994410 2:148906748-148906770 CCTCAGCCCCACTGAGGAGCTGG - Intronic
940616068 2:156049964-156049986 CCCCGGAGTCATTGAGGAGCAGG - Intergenic
941498812 2:166242501-166242523 CCAGGGCACCACTGCTGAGCAGG + Exonic
944301690 2:198131094-198131116 CCCTGGTGCCACTGAGGAAGTGG - Intronic
944933620 2:204545492-204545514 CGCGGGCGCCGCAGAGGAGTTGG + Intergenic
945190484 2:207182482-207182504 CCCAGGCCCCACAGAGGAGAGGG + Intergenic
946163574 2:217850201-217850223 CCCGGGGGCCCCTGAAGAACAGG + Intronic
946433844 2:219639539-219639561 CCAGGGAGCCAATGAGGAGCAGG - Exonic
946929200 2:224655634-224655656 ACCGGGCGCCACGGAGCAGGGGG - Intergenic
948809068 2:240465809-240465831 CCAGGGCGCCGCAGAGGTGCAGG - Intronic
949060495 2:241953794-241953816 CCCAGGCCCCAGGGAGGAGCCGG + Intergenic
1170594206 20:17793163-17793185 CCAGGGCACCACAGAGGAGCCGG - Intergenic
1170689791 20:18603657-18603679 CCCGGTAGTCACTCAGGAGCAGG - Intronic
1171973374 20:31578601-31578623 ACCGGGCGCCATGGAGGAGGGGG + Intergenic
1172122061 20:32604243-32604265 CCAGGCCACCCCTGAGGAGCTGG - Intronic
1172689140 20:36778539-36778561 CCTGGGCAGCACTAAGGAGCTGG + Exonic
1175429262 20:58890969-58890991 CGCGGGCGCCGCCGAGGGGCTGG - Intronic
1175997331 20:62817589-62817611 CCCGGGCGGCCCTGGGGGGCCGG - Exonic
1176138348 20:63534767-63534789 CCCAGGCCCCAGGGAGGAGCGGG + Intronic
1176385845 21:6138230-6138252 CCTGGGGGCCCCGGAGGAGCGGG + Intergenic
1177388436 21:20436149-20436171 CCCAGGAGTCACTGAGGAGTAGG - Intergenic
1179737628 21:43400022-43400044 CCTGGGGGCCCCGGAGGAGCGGG - Intergenic
1180101614 21:45590384-45590406 CCCGGCCGCCTCTGAGGTTCTGG + Intergenic
1180155009 21:45973393-45973415 CCCGGGCGCCCATCAGGGGCTGG - Intergenic
1181127022 22:20708541-20708563 CCCGGGCGCCACCTGGGGGCAGG + Intronic
1181240356 22:21473844-21473866 CCCGGGCGCCACCTGGGGGCAGG + Intergenic
1181696221 22:24594082-24594104 CCCTGGCTCCTCTGAGGACCAGG + Intronic
1181745412 22:24952564-24952586 CCCAGGCGCCACTGCGGACTCGG + Intergenic
1183353200 22:37344831-37344853 CCCCTGCGCACCTGAGGAGCAGG - Intergenic
1183440435 22:37819987-37820009 CCCCGGGGCCTTTGAGGAGCTGG + Intergenic
1183508356 22:38221513-38221535 CGCGGGCGCCACTGAGGCTGTGG + Exonic
1183537725 22:38412964-38412986 ACCGGGCGGCGCTGTGGAGCAGG + Intergenic
1184489032 22:44798750-44798772 GGCGAGTGCCACTGAGGAGCTGG + Intronic
1184680472 22:46070270-46070292 CTCAGGCGCCTCTGTGGAGCGGG + Intronic
949800939 3:7903603-7903625 CCCAGTAGTCACTGAGGAGCCGG + Intergenic
952011231 3:28903196-28903218 ACCGGGCGCCGCGGAGCAGCGGG + Intergenic
952288182 3:31988352-31988374 ACTGGGGGCCACTGAGGAGTAGG + Intronic
953460354 3:43077044-43077066 CCCAGGCTCCATGGAGGAGCTGG - Intergenic
954528981 3:51301690-51301712 CCCAGGAGTCACTCAGGAGCAGG + Intronic
955161433 3:56468310-56468332 CCCGGGCGGCCAGGAGGAGCAGG + Exonic
956269043 3:67430333-67430355 CCCAGTAGCCACTCAGGAGCAGG - Intronic
958197853 3:90265608-90265630 CCCAGTAGTCACTGAGGAGCAGG + Intergenic
958814697 3:98902027-98902049 CCCGGAAGTCACTGACGAGCTGG - Intergenic
967880620 3:194298811-194298833 CCGGGGTGCCACCGAGGAGCTGG - Intergenic
968144603 3:196287821-196287843 CCCGGGGGCCTCTGAGGAGGCGG - Intronic
968265217 3:197357445-197357467 CCCGGGCGGCACAGGGGAGATGG + Intergenic
968515515 4:1013931-1013953 CCCTGGCGGCACTGGGGAGCTGG + Intronic
968729717 4:2263949-2263971 CCCTGGCGTCACTGTGGGGCGGG - Intergenic
968756397 4:2418379-2418401 CCCGGGCCCGGCTGAGGCGCGGG + Exonic
969240355 4:5893072-5893094 CCCGGGCGCGACTGCGGCCCAGG + Intergenic
971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG + Intergenic
975160764 4:71121274-71121296 ACCGGGCGCCACGGAGCAGGGGG - Intergenic
977206577 4:94170176-94170198 ACCGGGCGCCATTGAGCAGGGGG - Intergenic
979967358 4:127091066-127091088 CCCAAGAGCCACTCAGGAGCAGG - Intergenic
981550274 4:145936586-145936608 CCCGGGTGACACGGAGGCGCGGG + Intronic
982840441 4:160177602-160177624 CCCGAGCATCATTGAGGAGCAGG - Intergenic
985198690 4:187461631-187461653 CACGGGCAGCCCTGAGGAGCTGG - Intergenic
986626488 5:9727818-9727840 CCAGGGCCCCAGTGAGGTGCAGG + Intergenic
987454153 5:18122228-18122250 CCCAGGAGTCACTCAGGAGCAGG - Intergenic
988500196 5:31777447-31777469 CCCAGGCGCCACGGAGCAGGGGG - Intronic
991474396 5:67004235-67004257 CCCGGCCGCGCCTGAGGAGCGGG - Intronic
995779836 5:115763104-115763126 CCCGGGCTGCACAGAGCAGCAGG + Intergenic
996287448 5:121811287-121811309 CCCAGGAGTCATTGAGGAGCAGG + Intergenic
996965512 5:129303353-129303375 CCCAGGAGTCACTCAGGAGCAGG + Intergenic
997512936 5:134465835-134465857 TCCGGGCGCCTCTGGGAAGCTGG + Intergenic
998087980 5:139342237-139342259 CCCTCGCGCCACTGAGGACCCGG - Intronic
998903706 5:146881035-146881057 CCTGTGCACCACTGTGGAGCTGG + Intronic
999305162 5:150514907-150514929 CCCGGGTGCCACTCAAGGGCAGG - Intronic
1002782971 6:380929-380951 CCAGGGCACCACTCCGGAGCAGG + Intergenic
1003049906 6:2770434-2770456 GCCGGGCGTCAGTGAGGAGAGGG + Intronic
1004760394 6:18659309-18659331 CCCAGGAGTCATTGAGGAGCAGG - Intergenic
1007765344 6:44156591-44156613 CCCAGGCGCCAGCAAGGAGCAGG + Intergenic
1009437724 6:63636471-63636493 CCCCGCCGCCGCTGAGGCGCGGG + Intronic
1009695575 6:67098278-67098300 CCCAGTAGCCACTCAGGAGCAGG - Intergenic
1010001778 6:70956252-70956274 CCGGGCCGCCCCTGCGGAGCGGG + Exonic
1012784340 6:103604188-103604210 CCCAGGAGTCACTCAGGAGCAGG + Intergenic
1017390853 6:153937996-153938018 CCCGGGAGTCATTCAGGAGCAGG + Intergenic
1017764203 6:157593507-157593529 CCCCAGCCCCTCTGAGGAGCTGG - Intronic
1017844315 6:158242808-158242830 CCTGGGCGACAGTGAGCAGCAGG - Intronic
1019128963 6:169859765-169859787 GCCGGCAGCCACAGAGGAGCAGG - Intergenic
1019266483 7:120029-120051 GCCAGGAGCCCCTGAGGAGCAGG + Intergenic
1019409073 7:898798-898820 GCCGGGCTGCCCTGAGGAGCAGG + Exonic
1019427189 7:983290-983312 CCCGGGGGCCACCGGGCAGCTGG - Exonic
1019528614 7:1492873-1492895 CCCGGGCGGGAGTGGGGAGCGGG + Intronic
1019528627 7:1492907-1492929 CCCGGGCGGGAGTGGGGAGCGGG + Intronic
1019528655 7:1492975-1492997 CCCGGGCGGGAGTGGGGAGCGGG + Intronic
1019542979 7:1559787-1559809 CCCCGGCCCCAGTGAGGAGGGGG - Intronic
1019605331 7:1907241-1907263 CCGGTGCCCCAGTGAGGAGCTGG + Intronic
1020525544 7:9253722-9253744 CCCAGGAGCCATTCAGGAGCAGG - Intergenic
1020867631 7:13587600-13587622 CCCAGGAGCCATTCAGGAGCAGG + Intergenic
1024574733 7:50754488-50754510 TCCTGGCGCCAGTGAGGAGAGGG - Intronic
1024578439 7:50782829-50782851 ACTGGGCGCTCCTGAGGAGCGGG + Intronic
1026970295 7:74463636-74463658 CCCAGGGGCCACCAAGGAGCGGG + Intronic
1029467677 7:100736591-100736613 CCCGGGGGCCCCGGTGGAGCCGG - Exonic
1031567795 7:123321420-123321442 CCCTGTAGCCACTGAAGAGCAGG - Intergenic
1032239428 7:130149511-130149533 CCCGGCCGCCCCGGGGGAGCAGG - Intergenic
1033036745 7:137882548-137882570 CCCGGGCTCGGCTGGGGAGCTGG - Exonic
1033227717 7:139574479-139574501 CACGGGCTCCACTGATGACCTGG + Intronic
1034441365 7:151087439-151087461 CCCCCGCCCCACTGCGGAGCAGG - Intronic
1034490656 7:151391529-151391551 CCCGGGCGAGACTGAGGGTCCGG + Intronic
1035104461 7:156430289-156430311 ACCTGGCGCCACTGGGGAGAGGG - Intergenic
1037173729 8:15923626-15923648 ACCGGGCGCCACAGAGCAGGGGG - Intergenic
1037865791 8:22441268-22441290 CTCGGACACCGCTGAGGAGCCGG + Exonic
1039194160 8:35011919-35011941 CCCAGTGGGCACTGAGGAGCTGG - Intergenic
1039842056 8:41301069-41301091 TCCGGGAGCCTCTGTGGAGCTGG - Intronic
1040470193 8:47730387-47730409 CCCAGGGGCCACTGAGTGGCTGG - Intronic
1041315080 8:56552571-56552593 CCCAGTAGTCACTGAGGAGCAGG - Intergenic
1041341339 8:56849142-56849164 CCCAGGAGCCATTCAGGAGCAGG - Intergenic
1041402218 8:57457693-57457715 GCTGTGAGCCACTGAGGAGCTGG - Intergenic
1046547218 8:115667974-115667996 ACCGGGCGCAGCGGAGGAGCTGG - Intronic
1049446037 8:142632129-142632151 CCTGGGCCCCCCTGGGGAGCTGG - Intergenic
1049597283 8:143490478-143490500 CCAGGGCCCCACTGGGGAGGAGG - Intronic
1049608456 8:143541032-143541054 CCCGCGCCCCACTGCGGGGCTGG - Intronic
1049673040 8:143878160-143878182 CCCGGGCGCCGGTGAAGAGGAGG - Intronic
1049789626 8:144466725-144466747 CAGGGGCGCCCCTGAGGAGGGGG - Intronic
1049812303 8:144580929-144580951 CTCGGGCTCCAGGGAGGAGCTGG + Exonic
1052451684 9:28639078-28639100 CCCAGTAGCCACTCAGGAGCAGG + Intronic
1052478570 9:28992747-28992769 CCCAGTAGCCACTCAGGAGCAGG - Intergenic
1053072036 9:35107475-35107497 CCCCGGCGCCTCCGAGGGGCTGG + Exonic
1060473845 9:123970624-123970646 ATGGGGCTCCACTGAGGAGCAGG + Intergenic
1060926873 9:127461336-127461358 CCCGGGAGCCATTGAGCAGGAGG + Intronic
1061403780 9:130382692-130382714 CCTGGGTGACACAGAGGAGCTGG + Intronic
1061536350 9:131252557-131252579 CCTGGGGGCCACAGAGGACCGGG - Intergenic
1061716579 9:132522086-132522108 CCCTGGCTCCTATGAGGAGCAGG + Intronic
1062044356 9:134418200-134418222 CCCAGGCCCCACTGAGGGGGTGG + Intronic
1062206583 9:135341028-135341050 CCAGGGCACCCCTGAGGTGCAGG - Intergenic
1192088974 X:68132789-68132811 GGCGAGCCCCACTGAGGAGCCGG + Intronic
1193030161 X:76889048-76889070 CCCAGTAGCCACTCAGGAGCAGG - Intergenic
1194021736 X:88699821-88699843 CCCAGGAGCCATTCAGGAGCAGG + Intergenic
1195686005 X:107586707-107586729 CCCAGGAGTCACTCAGGAGCAGG + Intronic
1196382054 X:115101100-115101122 CCCAGGAGCCATTCAGGAGCAGG - Intergenic
1196537676 X:116866864-116866886 CCCAGGAGTCACTCAGGAGCAGG + Intergenic
1196735276 X:118976580-118976602 CCCAGGCGGCACTGAAAAGCGGG - Intronic
1197177476 X:123500870-123500892 CCCAGGAGCCACTGAGGGCCAGG + Intergenic
1198424183 X:136497883-136497905 CACGGGCGCCACTGCAGAGCGGG + Intronic
1198571550 X:137962550-137962572 CCCAGTAGTCACTGAGGAGCAGG - Intergenic
1199307971 X:146290153-146290175 CCCAGGAGTCACTCAGGAGCAGG + Intergenic