ID: 1072286138

View in Genome Browser
Species Human (GRCh38)
Location 10:93917363-93917385
Sequence CAGTTTAAAAAAAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072286138_1072286144 10 Left 1072286138 10:93917363-93917385 CCCTCTTTCCTTTTTTTAAACTG No data
Right 1072286144 10:93917396-93917418 GCATAAGGCAGAAAGAGATTAGG No data
1072286138_1072286142 -5 Left 1072286138 10:93917363-93917385 CCCTCTTTCCTTTTTTTAAACTG No data
Right 1072286142 10:93917381-93917403 AACTGAGGTTTGCCTGCATAAGG No data
1072286138_1072286145 30 Left 1072286138 10:93917363-93917385 CCCTCTTTCCTTTTTTTAAACTG No data
Right 1072286145 10:93917416-93917438 AGGAAAACAGTTTGCAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072286138 Original CRISPR CAGTTTAAAAAAAGGAAAGA GGG (reversed) Intronic
No off target data available for this crispr