ID: 1072288058

View in Genome Browser
Species Human (GRCh38)
Location 10:93935679-93935701
Sequence GAGAGTGTGAAAAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072288050_1072288058 25 Left 1072288050 10:93935631-93935653 CCGTCTCAAAAAAAAAAAAAGAA 0: 3017
1: 89714
2: 69208
3: 85321
4: 120915
Right 1072288058 10:93935679-93935701 GAGAGTGTGAAAAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072288058 Original CRISPR GAGAGTGTGAAAAGGGTGGA AGG Intronic
No off target data available for this crispr