ID: 1072290491

View in Genome Browser
Species Human (GRCh38)
Location 10:93960437-93960459
Sequence CCATCCAGGGAGAGGCTCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072290491_1072290500 10 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155
1072290491_1072290503 13 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data
1072290491_1072290501 11 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205
1072290491_1072290504 17 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290504 10:93960477-93960499 TACAGAGCCTTTTGGGGGGCTGG No data
1072290491_1072290502 12 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290502 10:93960472-93960494 TGGAATACAGAGCCTTTTGGGGG No data
1072290491_1072290499 9 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187
1072290491_1072290497 -8 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072290491 Original CRISPR CCATCCAGGGAGAGGCTCGA CGG (reversed) Intergenic
No off target data available for this crispr