ID: 1072290497

View in Genome Browser
Species Human (GRCh38)
Location 10:93960452-93960474
Sequence CTGGATGGATTCCATGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072290484_1072290497 23 Left 1072290484 10:93960406-93960428 CCATATGGTCATCGGTCTCCATG 0: 1
1: 2
2: 0
3: 3
4: 109
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data
1072290483_1072290497 24 Left 1072290483 10:93960405-93960427 CCCATATGGTCATCGGTCTCCAT 0: 1
1: 2
2: 0
3: 2
4: 42
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data
1072290491_1072290497 -8 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data
1072290487_1072290497 -3 Left 1072290487 10:93960432-93960454 CCACCCCGTCGAGCCTCTCCCTG No data
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data
1072290486_1072290497 5 Left 1072290486 10:93960424-93960446 CCATGGTGCCACCCCGTCGAGCC 0: 1
1: 1
2: 0
3: 6
4: 60
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data
1072290490_1072290497 -7 Left 1072290490 10:93960436-93960458 CCCGTCGAGCCTCTCCCTGGATG No data
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data
1072290482_1072290497 27 Left 1072290482 10:93960402-93960424 CCACCCATATGGTCATCGGTCTC 0: 1
1: 2
2: 0
3: 4
4: 40
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data
1072290489_1072290497 -6 Left 1072290489 10:93960435-93960457 CCCCGTCGAGCCTCTCCCTGGAT No data
Right 1072290497 10:93960452-93960474 CTGGATGGATTCCATGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072290497 Original CRISPR CTGGATGGATTCCATGGCTG TGG Intergenic
No off target data available for this crispr