ID: 1072290499

View in Genome Browser
Species Human (GRCh38)
Location 10:93960469-93960491
Sequence CTGTGGAATACAGAGCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 3, 1: 1, 2: 0, 3: 20, 4: 187}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072290491_1072290499 9 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187
1072290496_1072290499 -5 Left 1072290496 10:93960451-93960473 CCTGGATGGATTCCATGGCTGTG No data
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187
1072290493_1072290499 1 Left 1072290493 10:93960445-93960467 CCTCTCCCTGGATGGATTCCATG No data
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187
1072290495_1072290499 -4 Left 1072290495 10:93960450-93960472 CCCTGGATGGATTCCATGGCTGT No data
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187
1072290487_1072290499 14 Left 1072290487 10:93960432-93960454 CCACCCCGTCGAGCCTCTCCCTG No data
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187
1072290490_1072290499 10 Left 1072290490 10:93960436-93960458 CCCGTCGAGCCTCTCCCTGGATG No data
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187
1072290489_1072290499 11 Left 1072290489 10:93960435-93960457 CCCCGTCGAGCCTCTCCCTGGAT No data
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187
1072290486_1072290499 22 Left 1072290486 10:93960424-93960446 CCATGGTGCCACCCCGTCGAGCC 0: 1
1: 1
2: 0
3: 6
4: 60
Right 1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG 0: 3
1: 1
2: 0
3: 20
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072290499 Original CRISPR CTGTGGAATACAGAGCCTTT TGG Intergenic
901098945 1:6704230-6704252 CTTTGGAAAACACAGCCTCTAGG + Intergenic
901917616 1:12512015-12512037 CTGTGGAATAAAATGCCTTGTGG + Exonic
902220535 1:14961632-14961654 CTGGGGAAAACACAGCCTTTGGG + Intronic
905361414 1:37423394-37423416 CTGGGGAATGCTGAGGCTTTTGG - Intergenic
906780700 1:48570458-48570480 CTGTGGAATCCTGGGGCTTTGGG + Intronic
907126767 1:52056907-52056929 CTGTGCAACACTGAGCCTGTCGG - Intronic
907261686 1:53222870-53222892 CTGCTGACTAAAGAGCCTTTGGG + Intergenic
914839515 1:151236683-151236705 CTGTGGAATACAGAGCCTTTTGG - Exonic
917315601 1:173721747-173721769 GTGTGGAATATAGTGCCTATTGG + Intronic
917387294 1:174491261-174491283 CTGTGGACTAAAGAACCCTTTGG - Intronic
919733864 1:200932191-200932213 CTTTGGAAGCCAGAGGCTTTGGG + Intergenic
920911202 1:210218668-210218690 CTGTGTAATACATAGGTTTTAGG - Intergenic
922983285 1:229846969-229846991 CTGTGTTATTCAGAGCCTTGTGG + Intergenic
1062919737 10:1270856-1270878 TTGTGGAAGAGAGAGCCTTTTGG + Intronic
1063255906 10:4326923-4326945 CAGTGGACTTCAAAGCCTTTTGG - Intergenic
1065849167 10:29772517-29772539 CTGTGGAAAGCAGAGCCTGAGGG + Intergenic
1066409825 10:35156624-35156646 ATTTGGAAAACAGAGGCTTTGGG + Intronic
1066489071 10:35876445-35876467 CCGTGGATGACAGAGACTTTAGG + Intergenic
1066503737 10:36020583-36020605 CTGTGGAATAATGAGCCATGTGG + Intergenic
1067309205 10:45096295-45096317 CCGTGGATGACAGAGACTTTGGG + Intergenic
1067763582 10:49069107-49069129 ATGGGGAAGACAGAGCCTTCAGG - Intronic
1070089430 10:73270344-73270366 CTGGGGAAGGGAGAGCCTTTTGG - Intronic
1070172246 10:73941499-73941521 ATTTGGAAAATAGAGCCTTTTGG + Intergenic
1070572308 10:77649738-77649760 CTGGGGAACAAAGAGGCTTTGGG - Intergenic
1071109345 10:82136709-82136731 CTGCTGAATAAAGAGCCCTTGGG - Intronic
1072058758 10:91787972-91787994 CTGCTGACTAAAGAGCCTTTGGG + Intergenic
1072290499 10:93960469-93960491 CTGTGGAATACAGAGCCTTTTGG + Intergenic
1072576071 10:96701356-96701378 CTTTGGAACACAGGGCCTTTGGG - Intronic
1073516778 10:104083016-104083038 CTGTGGAACACACAGACATTGGG - Intronic
1074141649 10:110678856-110678878 CTCAGCAATACAGAGACTTTTGG + Intronic
1074350598 10:112733132-112733154 CTCTGGAATACAAGGCTTTTTGG + Intronic
1075125034 10:119692758-119692780 CTTTGGAATACAGACCCATCTGG + Intergenic
1075557552 10:123444427-123444449 CAGTGTAATACAGAGTCTTGAGG + Intergenic
1076252577 10:128995864-128995886 CTGTGGGCTCCAGGGCCTTTGGG + Intergenic
1079239928 11:18715012-18715034 CTGTGGGATACATAGACTGTGGG + Intronic
1079257100 11:18840708-18840730 CTGTGGAAGACTGACTCTTTAGG + Intergenic
1079368583 11:19831012-19831034 CAGTGGAAGACAGAGCTTCTAGG + Intronic
1080004964 11:27397087-27397109 CAGGGGAAAAGAGAGCCTTTGGG - Intronic
1080455938 11:32419363-32419385 CTGGGGAATACAATGCCTGTTGG - Intronic
1082708746 11:56527071-56527093 CAGGCGAATACAGAGCCCTTTGG + Intergenic
1082850911 11:57763967-57763989 GTGTGTAGTACAGAGCCTTTGGG + Intronic
1084097793 11:66923482-66923504 CTATGGAATACATAGGATTTGGG + Intronic
1084352525 11:68612733-68612755 CTGTGGCTTCCAGAGCCTTCAGG - Intronic
1085147298 11:74212802-74212824 CTGCTGACTAAAGAGCCTTTGGG + Intronic
1085223439 11:74895979-74896001 CTGTTGACTAAAGAGCCCTTCGG + Intronic
1085606449 11:77903838-77903860 ATCTGGGACACAGAGCCTTTGGG - Intronic
1088157207 11:106821700-106821722 CAGTGTAATAGAGAGCCATTTGG + Intronic
1089899540 11:121966380-121966402 CCATGGAATACAAAGCCTTCTGG + Intergenic
1090497774 11:127231476-127231498 CTGTGGATTTCAGAGTCTTCTGG + Intergenic
1092312491 12:7373624-7373646 CTGTAGAATTCACAGCCTTGAGG - Exonic
1093420195 12:18966200-18966222 CTTTGGAATTCAGAGACCTTTGG - Intergenic
1096613261 12:52816873-52816895 CTATAGAATATGGAGCCTTTGGG - Intergenic
1098959116 12:76719743-76719765 CTGCTGAATAAAGAGCCCTTGGG + Intergenic
1099764176 12:86961015-86961037 CTGCTGATTAAAGAGCCTTTAGG - Intergenic
1105468764 13:20672640-20672662 TTGTGGAATTCAGAACCTTTTGG + Intronic
1106905729 13:34407204-34407226 CTGACTAATACAGTGCCTTTAGG + Intergenic
1109551088 13:63901638-63901660 CTGTGGAATATTGTGCATTTTGG - Intergenic
1111030629 13:82592672-82592694 CTGTGGCATAAAGGCCCTTTGGG - Intergenic
1112011544 13:95297772-95297794 CTGTGGATTACAGTGTCCTTGGG + Intronic
1117336980 14:54764295-54764317 CTGTGGAATGAGGAGCCTCTTGG + Intronic
1120100200 14:80435741-80435763 CTGTTGATTAAAGAGCCCTTGGG + Intergenic
1123029965 14:105446952-105446974 CAGTGGAGTACACAGGCTTTGGG - Intronic
1123165760 14:106323815-106323837 CTGTCCAATACAGAGCCACTGGG + Intergenic
1124861830 15:33449324-33449346 CTGTGGAATCCACTGCCTTACGG - Intronic
1126299786 15:47183227-47183249 CTGTGGAAAACAAAGCATTTTGG - Intergenic
1127545863 15:59994092-59994114 CTTTGGGAAACAGAGCCTTCAGG + Intergenic
1127778323 15:62287474-62287496 CTCTGGAGCACACAGCCTTTAGG - Intergenic
1128901076 15:71423384-71423406 CTGCTGACTAAAGAGCCTTTGGG - Intronic
1131804717 15:96109380-96109402 CTGTGCAACACAGAGCCTGGAGG + Intergenic
1132436792 15:101812509-101812531 TTGTGGTATCCAGAGACTTTTGG + Intronic
1133921449 16:10156955-10156977 CTGTGGGAGACAGAGCCTGGTGG + Intronic
1135703404 16:24653308-24653330 CTGTGGAAAACAAAGCCCTTCGG + Intergenic
1136991313 16:35152858-35152880 CTGTGGAATGCAGAGGCATGGGG + Intergenic
1138337186 16:56262330-56262352 GTTTGGATGACAGAGCCTTTTGG + Intronic
1143447038 17:7015696-7015718 CTGTGGGATGCATAGCCTGTGGG + Intronic
1146558376 17:33847129-33847151 CTCTGGAAAACAGAGACTTCTGG + Intronic
1147345504 17:39790158-39790180 CTGTTTAAAACAGAGGCTTTGGG + Intronic
1147729078 17:42586101-42586123 CTGTGGGATACTGACCTTTTTGG - Exonic
1147973693 17:44235469-44235491 CTCTGGAATACTGAGACTATAGG + Intergenic
1148523349 17:48303683-48303705 CTGTAGAATACACAGGCTTGGGG + Intronic
1149963261 17:61135927-61135949 ATGTGGCATACAAAGCCTTTAGG + Intronic
1150472226 17:65446939-65446961 CTGTGGAATACAGAGGAGTGGGG + Intergenic
1150550454 17:66204726-66204748 CTGTTGACTAAAGAGCCTTTAGG + Intergenic
1150631105 17:66881064-66881086 CTTTCCAATGCAGAGCCTTTTGG - Intronic
1150834371 17:68551157-68551179 CTGTGGGCTGCAGATCCTTTGGG + Intronic
1153149028 18:2068760-2068782 ATGTGGAACACAGAACTTTTTGG - Intergenic
1153403607 18:4709021-4709043 AAGTGGAATACAGAGAATTTTGG + Intergenic
1154317236 18:13314202-13314224 CTGAGAAATCCAGAGCCATTAGG - Intronic
1154385694 18:13889927-13889949 CTGTGCAACACAAAGCCTGTGGG - Intronic
1157226497 18:45870406-45870428 CTGTGGAAAACAGTGTCTTGTGG - Intronic
1160191387 18:76717018-76717040 CTGACTAATACAGGGCCTTTGGG - Intergenic
1162441506 19:10695261-10695283 CTGAGGAATACAGAACATTCAGG - Intergenic
1167579961 19:50335430-50335452 CTGTGGAAGGTAGAGCTTTTGGG + Intronic
926834173 2:16999223-16999245 CTGCTGACTAAAGAGCCTTTGGG - Intergenic
931085984 2:58831112-58831134 CTGCTGAATAAAGAGCCTTTGGG - Intergenic
931496777 2:62816162-62816184 CTGTGTAATACAGACTGTTTTGG - Intronic
932002184 2:67895251-67895273 GTGTGGAATACACAGCATTGTGG + Intergenic
933269879 2:80221822-80221844 GTGTGCAAGACAGATCCTTTTGG + Intronic
934565597 2:95338743-95338765 CTGTGGCAGACAGAGACTTCTGG - Intronic
937095301 2:119231414-119231436 CTGTGGAATGCAGGCCCATTGGG + Intronic
939401308 2:141698208-141698230 CTGTGGAGTATAGAACCTCTAGG + Intronic
940801016 2:158132416-158132438 CTGTGTAATACTGGGCCATTTGG + Intronic
941286172 2:163615391-163615413 CTTCGAAGTACAGAGCCTTTTGG + Intronic
942504787 2:176630149-176630171 CTGTGTACTTCAGGGCCTTTGGG + Intergenic
945508264 2:210668221-210668243 CTGTGGAAAGCATTGCCTTTAGG - Exonic
1169597282 20:7214488-7214510 CTGCTGACTAAAGAGCCTTTGGG + Intergenic
1172825964 20:37786286-37786308 CTGTTGACTGTAGAGCCTTTGGG - Intronic
1172991401 20:39039805-39039827 CTGTGGCATACAGCAGCTTTGGG + Intergenic
1173166488 20:40689974-40689996 AAGAGGAATTCAGAGCCTTTGGG - Intergenic
1173288979 20:41697811-41697833 CTGAGGATTAAAGAGCCTCTAGG - Intergenic
1174379798 20:50149286-50149308 CTGGGGATTACAGAGGCTCTTGG - Intronic
1175063462 20:56264818-56264840 TTCTGGAATACAGAGCATGTGGG - Intergenic
1176263941 20:64198793-64198815 CTCTGGAGTACAGAGCCATCAGG - Intronic
1178454041 21:32730172-32730194 CTGTGCAATGAAGAGCCTGTGGG + Intergenic
1179327310 21:40360454-40360476 CTGTGGAAGGCAGAGAGTTTAGG - Intronic
1183412162 22:37661181-37661203 CTGTGGAATCCAGACCCCTTTGG + Intronic
1184393786 22:44220767-44220789 CTGTGGCATCAAGAGCCTTGTGG + Intergenic
950020344 3:9782917-9782939 CTGTGGAATAGCTACCCTTTAGG - Intronic
957903159 3:86523577-86523599 ATCTGGAATTCAGAGCCTTCAGG + Intergenic
958437668 3:94117322-94117344 CTGTAGGTTACAGAGCTTTTTGG + Intronic
959448309 3:106467447-106467469 CTGCTGAATAAAGAGCCCTTGGG - Intergenic
959775264 3:110152136-110152158 CTGTGGATTAAAGAGATTTTAGG + Intergenic
960153547 3:114275185-114275207 CTGCTGAATAAAGAGCCCTTGGG - Intergenic
960207335 3:114918555-114918577 CTGCTGACTAAAGAGCCTTTGGG - Intronic
960501074 3:118439124-118439146 CTGCTGAATCCAGAGCCTCTAGG + Intergenic
963847349 3:150172602-150172624 CTCTGGCATGCAGAGCCTGTGGG - Intergenic
964295356 3:155227167-155227189 TTGTGGATTACTGAGACTTTTGG - Intergenic
965778856 3:172262146-172262168 CTGTGGAATAAAGATAATTTGGG + Intronic
967677570 3:192317699-192317721 CTGCTGATTACAGAGCCCTTGGG + Intronic
969456306 4:7301635-7301657 CTGAGGAACACAGAGGGTTTGGG - Intronic
969584425 4:8083873-8083895 TTGTGGAAGAGGGAGCCTTTTGG - Intronic
973615913 4:52677716-52677738 CTGTGGAATGGATAGCCTTATGG - Intergenic
973800581 4:54473740-54473762 TATTGGAATACAGAGACTTTGGG - Intergenic
974353019 4:60774012-60774034 CTGATGAATACAGAGTCCTTGGG - Intergenic
974469640 4:62302226-62302248 CTGTTGACTAAAGAGCCCTTGGG + Intergenic
975605431 4:76149504-76149526 CTGAGGAAGATAGAGCTTTTAGG + Intergenic
982357315 4:154485164-154485186 GAGGGGAAGACAGAGCCTTTGGG + Intronic
984001241 4:174248415-174248437 CTGTGTAACACAGAGCCTTCTGG - Intronic
985307007 4:188554549-188554571 GCCTGGAATCCAGAGCCTTTAGG - Intergenic
987539777 5:19239543-19239565 CTATTCAATACAGAGGCTTTAGG - Intergenic
990773690 5:59281034-59281056 CCATGGAAGACAGAGACTTTGGG - Intronic
991551231 5:67838142-67838164 GTCTGGAATAAAGAGCCTATGGG - Intergenic
992098134 5:73381406-73381428 TTGTGAAAGACAGAACCTTTGGG + Intergenic
992531808 5:77659502-77659524 CTGCTGAATAAAGAGCCCTTGGG - Intergenic
993865430 5:93188965-93188987 CTGGGCAATACATAGGCTTTTGG + Intergenic
994098203 5:95866494-95866516 CTGAGGAACCCAGAGCCCTTTGG - Intergenic
994330461 5:98499263-98499285 GTGTGCAAGAAAGAGCCTTTTGG - Intergenic
994820612 5:104646256-104646278 GTGTGGAATAAAGAGGCTTTGGG - Intergenic
996544243 5:124660851-124660873 GTGTGGAATTCATAGCATTTTGG - Intronic
999771180 5:154776726-154776748 CTGTGGTCTACAGAGCATCTGGG - Intronic
999802996 5:155055038-155055060 CTGTGTTCTACAGAACCTTTGGG + Intergenic
1003020305 6:2504160-2504182 CTGTGGAATGAAGGGCCTGTGGG + Intergenic
1003653860 6:7987565-7987587 CTGTGGAATACAGAGCCTTTTGG - Intronic
1003733776 6:8854775-8854797 CTATCGAATACAGAACCTTTAGG + Intergenic
1005757706 6:28940162-28940184 CTGTAGACTGCAGAGTCTTTGGG + Intergenic
1007021841 6:38528730-38528752 CTGCTGACTAAAGAGCCTTTGGG + Intronic
1010018731 6:71135380-71135402 CTGCTGACTAAAGAGCCTTTGGG + Intergenic
1012889639 6:104883706-104883728 CTGGGGAATACACATCCTTAAGG - Intergenic
1012894640 6:104934674-104934696 CTGTGTAATTCAGAGCTTTAAGG - Intergenic
1013988085 6:116220457-116220479 CTGTCAAATACAGTGCCTTTTGG + Intronic
1014320132 6:119917580-119917602 CTGAGGAATACAGCTGCTTTTGG + Intergenic
1014878887 6:126696971-126696993 CTGTGGAATACATAGCTGTGTGG - Intergenic
1015660315 6:135567028-135567050 CTGTGTAGGGCAGAGCCTTTGGG + Intergenic
1017296036 6:152795919-152795941 CTTTTGAATACAGACCCATTTGG - Intergenic
1017296343 6:152799561-152799583 CTATGAAATATAGAGCCTTTTGG - Intergenic
1022396458 7:29991371-29991393 CTATGGAATTCAGAGTCTCTGGG + Intergenic
1022842919 7:34181924-34181946 GTGTGGAGAACAGAGCCTTGAGG - Intergenic
1025846193 7:65200378-65200400 ATCTGGGACACAGAGCCTTTGGG + Intergenic
1025896413 7:65706106-65706128 ATCTGGGACACAGAGCCTTTGGG + Intergenic
1027866241 7:83650996-83651018 CAATGGAATAAAGAGTCTTTGGG + Intergenic
1028207578 7:88034231-88034253 CTGCTAAATATAGAGCCTTTGGG - Intronic
1032577496 7:133071081-133071103 CTGAGGAACACACAGCCTTGCGG + Intronic
1035346915 7:158206385-158206407 CTCCTGACTACAGAGCCTTTGGG + Intronic
1035486790 7:159232455-159232477 CTGTGGAATACAGAGCCCTTTGG - Intergenic
1035819837 8:2579582-2579604 CTGTGGCATACACAGGCCTTCGG - Intergenic
1035976571 8:4319369-4319391 CTTTGAAATACTGAGCCTCTGGG + Intronic
1038307483 8:26417674-26417696 CTATGGATTTCAGAGCATTTTGG + Intronic
1039739698 8:40370882-40370904 CTGTGGGATACAGAGCATAAAGG + Intergenic
1040866430 8:52052984-52053006 CTGTGGAAGCCAGAGCCCTGCGG + Intergenic
1041091118 8:54301674-54301696 CCATGGAATAGATAGCCTTTGGG + Intergenic
1042213127 8:66401477-66401499 CTGTGGCATACAGTGTCATTTGG + Intergenic
1042411982 8:68476623-68476645 CTTTGTAATACAGACCCTGTAGG - Intronic
1047342801 8:123999254-123999276 CTGCAGACTAAAGAGCCTTTGGG - Intronic
1047933610 8:129753453-129753475 CTGCTGAATACAGAACCATTGGG + Intronic
1048083241 8:131151107-131151129 CTGTGCTATACAAAGGCTTTGGG - Intergenic
1050166419 9:2769453-2769475 ATGTGGCATACATAGCCTCTGGG + Intronic
1050238736 9:3612360-3612382 CTACTGATTACAGAGCCTTTGGG - Intergenic
1051925428 9:22319152-22319174 CTGTGGGATAAAGTGGCTTTTGG - Intergenic
1052434031 9:28403177-28403199 TTTTGGAATACAGAGCCAGTGGG - Intronic
1053056378 9:34995301-34995323 CTCCGGAATACAGAGACTATGGG - Intronic
1056516745 9:87359388-87359410 CTGTGCACTAAAGAGCCCTTTGG + Intergenic
1059839055 9:118191792-118191814 CTGTTGACTAAAGAGCCCTTGGG + Intergenic
1059860922 9:118460470-118460492 CTGTGAAATACAGGGCGGTTTGG - Intergenic
1061528560 9:131190716-131190738 CTCTGGAATACAGAATCTATAGG - Intronic
1062071037 9:134555094-134555116 CTGTGGACCACTGAGCCTTTGGG - Intergenic
1062090591 9:134676601-134676623 CAGTGGAAGAAGGAGCCTTTCGG - Intronic
1186158227 X:6748241-6748263 CTCTGAAATACAGAGCCCTCGGG + Intergenic
1187618080 X:21020313-21020335 CTGCTGAATAAAGAGCCTTTGGG + Intergenic
1188262032 X:28033873-28033895 CTGTGGAACCCAGGGCCCTTTGG - Intergenic
1188262491 X:28036875-28036897 CTGTGGAATCCACAACCTTTTGG - Intergenic
1188706418 X:33338017-33338039 CTATGTAATACAGAATCTTTCGG - Intronic
1191834139 X:65446039-65446061 CTGCAGACTAAAGAGCCTTTGGG - Intronic
1191991250 X:67039143-67039165 CTGCTGACTAAAGAGCCTTTGGG - Intergenic
1194012841 X:88583786-88583808 TTGTGGGATACAGAGCAGTTTGG - Intergenic
1195114945 X:101687931-101687953 CTGTGGCATCTAGGGCCTTTGGG - Intergenic
1195296942 X:103488009-103488031 CTGTTGACAACAGACCCTTTTGG + Intergenic
1195485676 X:105403167-105403189 CTTTGAAATACAGAGCCAATTGG - Intronic
1196510143 X:116499651-116499673 CTGCTGACTAAAGAGCCTTTGGG - Intergenic
1196532096 X:116799760-116799782 CTGTGGAGTACACACCATTTCGG + Intergenic
1198635272 X:138691179-138691201 CTGAGGAAGATAGAGCCTATGGG - Intronic
1200379518 X:155820005-155820027 CTGTGGAATAATGAGCCCTTGGG + Intergenic