ID: 1072290500

View in Genome Browser
Species Human (GRCh38)
Location 10:93960470-93960492
Sequence TGTGGAATACAGAGCCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 3, 1: 1, 2: 2, 3: 16, 4: 155}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072290487_1072290500 15 Left 1072290487 10:93960432-93960454 CCACCCCGTCGAGCCTCTCCCTG No data
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155
1072290496_1072290500 -4 Left 1072290496 10:93960451-93960473 CCTGGATGGATTCCATGGCTGTG No data
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155
1072290491_1072290500 10 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155
1072290490_1072290500 11 Left 1072290490 10:93960436-93960458 CCCGTCGAGCCTCTCCCTGGATG No data
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155
1072290495_1072290500 -3 Left 1072290495 10:93960450-93960472 CCCTGGATGGATTCCATGGCTGT No data
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155
1072290489_1072290500 12 Left 1072290489 10:93960435-93960457 CCCCGTCGAGCCTCTCCCTGGAT No data
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155
1072290486_1072290500 23 Left 1072290486 10:93960424-93960446 CCATGGTGCCACCCCGTCGAGCC 0: 1
1: 1
2: 0
3: 6
4: 60
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155
1072290493_1072290500 2 Left 1072290493 10:93960445-93960467 CCTCTCCCTGGATGGATTCCATG No data
Right 1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG 0: 3
1: 1
2: 2
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072290500 Original CRISPR TGTGGAATACAGAGCCTTTT GGG Intergenic
900211330 1:1457292-1457314 TGTGAAAAACACAGCATTTTTGG + Intronic
902220536 1:14961633-14961655 TGGGGAAAACACAGCCTTTGGGG + Intronic
903656973 1:24955492-24955514 TGGGGAATCCAGAGCATTTATGG + Intronic
904067129 1:27761990-27762012 TTTGAACTACAGAGCATTTTTGG + Intronic
904698553 1:32344603-32344625 TGGGGAATACACATACTTTTGGG + Intergenic
906810188 1:48818910-48818932 TGTGGAATATAGTGACTTTGTGG - Intronic
908833811 1:68208689-68208711 TATGGAAGACATAGCCTCTTTGG - Intronic
910796278 1:91100610-91100632 TGTGGAATCCACAGTCTTGTGGG - Intergenic
911351144 1:96756798-96756820 GGTGGAGTACAGAGGATTTTAGG + Intronic
912809019 1:112779683-112779705 TGTGCACTACACAGCCTTTCAGG + Intergenic
913693551 1:121302200-121302222 TGTGGAAGACAGAGAGTTTATGG + Intronic
914144006 1:144977880-144977902 TGTGGAAGACAGAGAGTTTATGG - Intronic
914329104 1:146649484-146649506 CTAGGAATACAGAGCCTGTTGGG - Intergenic
914839514 1:151236682-151236704 TGTGGAATACAGAGCCTTTTGGG - Exonic
917315602 1:173721748-173721770 TGTGGAATATAGTGCCTATTGGG + Intronic
918977584 1:191510718-191510740 TGTGCATTCCATAGCCTTTTTGG + Intergenic
920480874 1:206320569-206320591 TGTGGAAGACAGAGAGTTTATGG + Intronic
923249762 1:232168974-232168996 TGTGTAATACAGACCCTGTGAGG + Intergenic
923707351 1:236354961-236354983 TGTGTAATACAGACCCTGTGAGG + Intronic
924253274 1:242157443-242157465 TTTGGAATTCTCAGCCTTTTTGG + Intronic
924629169 1:245721073-245721095 TGTGGTATAGACTGCCTTTTAGG - Intergenic
1063255905 10:4326922-4326944 AGTGGACTTCAAAGCCTTTTGGG - Intergenic
1068173912 10:53431641-53431663 TGTAGAAGTCAAAGCCTTTTAGG - Intergenic
1069064771 10:63930834-63930856 TGTGTGAGACAGTGCCTTTTCGG + Intergenic
1070172247 10:73941500-73941522 TTTGGAAAATAGAGCCTTTTGGG + Intergenic
1071898418 10:90090736-90090758 TGTGGATGACAGAACGTTTTAGG - Intergenic
1072290500 10:93960470-93960492 TGTGGAATACAGAGCCTTTTGGG + Intergenic
1074350599 10:112733133-112733155 TCTGGAATACAAGGCTTTTTGGG + Intronic
1074387796 10:113030829-113030851 TTTGGAATCCACAGCCCTTTGGG + Intronic
1082850912 11:57763968-57763990 TGTGTAGTACAGAGCCTTTGGGG + Intronic
1085470920 11:76757255-76757277 TATGGAAAACATTGCCTTTTCGG + Intergenic
1085481244 11:76824549-76824571 GCTGGAATACAAGGCCTTTTGGG + Intergenic
1090497775 11:127231477-127231499 TGTGGATTTCAGAGTCTTCTGGG + Intergenic
1091188273 11:133666674-133666696 TCTGCAACACAGAGACTTTTGGG + Intergenic
1091944575 12:4525458-4525480 AGTGAAATACAGTGACTTTTAGG - Intronic
1092612286 12:10185389-10185411 TGAGGAATACAGTGTCTTTCTGG - Intronic
1092887038 12:12933915-12933937 TGTGTAATACAGACCCTGTGAGG - Intergenic
1093420194 12:18966199-18966221 TTTGGAATTCAGAGACCTTTGGG - Intergenic
1096025245 12:48355120-48355142 TGTGGAATACAGAGTTCCTTGGG + Intergenic
1096372662 12:51082365-51082387 TGTGGAAGACAGATCTTTGTGGG + Intronic
1098961278 12:76742040-76742062 TGTGTAATACAGACCCTGTGAGG - Intergenic
1100889741 12:99111621-99111643 TAAGGAATACAGAGCCGTGTAGG - Intronic
1101125552 12:101630009-101630031 AGTGGAATATAGGGTCTTTTTGG - Intronic
1104494180 12:129221207-129221229 TCTGGAACACAGAGCCTCCTTGG - Intronic
1106899611 13:34341243-34341265 TGTGAAAGACAGAGCCTCATAGG - Intergenic
1106945485 13:34823223-34823245 TGTGGAATAGTGAGCATTATTGG - Intergenic
1109070832 13:57765080-57765102 TGTGGAAACCAGCACCTTTTTGG + Intergenic
1109374523 13:61473991-61474013 TCTGGAATAAAAAGCCTTTATGG + Intergenic
1110114923 13:71801641-71801663 TATGAAATACAGAGCATTTCTGG + Intronic
1115481109 14:33862107-33862129 GGTGGAATCCAGGACCTTTTAGG - Intergenic
1115666544 14:35555476-35555498 TATGGTATACAGAGCAGTTTTGG - Intronic
1119973155 14:78995205-78995227 TGTGGAATTCAGAACATTTCAGG + Intronic
1123829015 15:24114769-24114791 TGTGTTATTCAAAGCCTTTTGGG - Intergenic
1131279798 15:91011635-91011657 TGTGTAATAGAGAGGCTTGTAGG + Intronic
1132436793 15:101812510-101812532 TGTGGTATCCAGAGACTTTTGGG + Intronic
1133308426 16:4826605-4826627 TGTTGAATGCAGAGGTTTTTGGG + Intronic
1134086425 16:11360456-11360478 TTTGGGACACATAGCCTTTTTGG + Intronic
1136930970 16:34417629-34417651 TTTGCAATACAGAGCATGTTCGG + Intergenic
1136973603 16:34994179-34994201 TTTGCAATACAGAGCATGTTCGG - Intergenic
1138964624 16:62069195-62069217 GGTGGAACACAGAGGATTTTTGG - Intergenic
1140004460 16:71061449-71061471 CTAGGAATACAGAGCCTGTTGGG + Intronic
1140732082 16:77865498-77865520 TGTGGAATATAGAGTCTTAACGG + Intronic
1142347308 16:89561983-89562005 TTTGGAATACGAAGCATTTTAGG - Intronic
1143256032 17:5558696-5558718 TATGGAATACATGGCCTGTTTGG - Exonic
1143565750 17:7719551-7719573 TGTGGAGTACAGAGCCCTTGTGG + Intronic
1144097109 17:11909792-11909814 TGTGCAATTCAAAGCATTTTAGG + Intronic
1146558377 17:33847130-33847152 TCTGGAAAACAGAGACTTCTGGG + Intronic
1148401393 17:47364804-47364826 TGTGGTTTACAGGGCCTTGTGGG + Intronic
1148552427 17:48558471-48558493 TCTGGAGTACAGAGCCCATTTGG + Intronic
1150631104 17:66881063-66881085 TTTCCAATGCAGAGCCTTTTGGG - Intronic
1151960610 17:77403504-77403526 TGTGGGACACAGGGCCTGTTTGG + Intronic
1152792178 17:82286837-82286859 GGTGGAACACAGAGGATTTTAGG + Intergenic
1153149027 18:2068759-2068781 TGTGGAACACAGAACTTTTTGGG - Intergenic
1153403608 18:4709022-4709044 AGTGGAATACAGAGAATTTTGGG + Intergenic
1154399197 18:14019142-14019164 TTTGGAATGTAGAGCCTTTGAGG + Intergenic
1156069600 18:33190327-33190349 TCTGAGAAACAGAGCCTTTTAGG - Intronic
1157040928 18:44037992-44038014 TGAGAAATAAAGAGCCTTGTTGG + Intergenic
1157282406 18:46354763-46354785 TGTGCAATAGATGGCCTTTTAGG + Intronic
1157681961 18:49614290-49614312 CTTGGAAGACAGAGCCTTTTAGG - Intergenic
1158152518 18:54388538-54388560 ATTGGAAGACAGAGACTTTTGGG - Intergenic
1158661879 18:59395934-59395956 TGTGGATTTCTGACCCTTTTAGG - Intergenic
1161078998 19:2301069-2301091 TGTGGGATGCAGAGTCTCTTGGG - Intronic
1166459094 19:42970206-42970228 TGTGAAATACACAGACTTTATGG - Intronic
1166476040 19:43125481-43125503 TGTGAAATACACAGACTTTATGG - Intronic
925691110 2:6524424-6524446 AGAGGAATAGAGAGCCTTTCAGG - Intergenic
925789995 2:7474947-7474969 TGTGAAAAACAGAGACCTTTCGG + Intergenic
928120204 2:28578474-28578496 TGTCTTATACAGAGCCCTTTCGG - Intronic
930300853 2:49613677-49613699 GGTGGAATTTAGAGCCTATTTGG + Intergenic
930572226 2:53101812-53101834 TGTCCACTTCAGAGCCTTTTTGG + Intergenic
932510718 2:72286511-72286533 GGTGGAGTACAGAGGATTTTAGG + Intronic
933081128 2:77988119-77988141 GGTGGATTACAGAGATTTTTAGG + Intergenic
933479380 2:82835909-82835931 TGTGCAATATAGAGTATTTTTGG + Intergenic
936420590 2:112360119-112360141 GGTGGAACACGGAGACTTTTTGG - Intergenic
939808168 2:146800480-146800502 TGTGGAAAACACAGCATTTTTGG + Intergenic
941144383 2:161825555-161825577 TGTGGAATATAGAGTCATCTTGG - Intronic
942702842 2:178732933-178732955 TGTGGAAGGCACAGCCTCTTTGG - Exonic
946093554 2:217251841-217251863 CGTGGAATACAGAGCATATAAGG + Intergenic
1170900047 20:20453705-20453727 TGTTGAATACAGAGCACATTAGG - Intronic
1173910177 20:46662493-46662515 AGTAGAATACAGAGACTTATGGG + Intronic
1173966103 20:47114092-47114114 TGTCTTATACAGAGCCTTTGAGG - Intronic
1174956793 20:55106401-55106423 TGTGGAAAGCAGGGGCTTTTGGG + Intergenic
1184393787 22:44220768-44220790 TGTGGCATCAAGAGCCTTGTGGG + Intergenic
1185098413 22:48824210-48824232 TGTGGAGGACAGAGCCTCCTTGG + Intronic
949092224 3:41799-41821 TGTGTAAGACAGAGACTCTTAGG + Intergenic
949304751 3:2627444-2627466 TGTGGATGACAGAGCCCTGTTGG - Intronic
951170883 3:19540516-19540538 TGGGGAACACAGAGCCCTCTGGG + Intergenic
951583236 3:24187662-24187684 TGTGGGATACACAGCCATCTAGG + Intronic
955454911 3:59109582-59109604 TCTGGCATAAAGAGCCTTTTAGG + Intergenic
956919618 3:73913181-73913203 TGAGGAATACAGAGTTTGTTTGG - Intergenic
957032487 3:75257754-75257776 TGTGTAAGACAGAGACTCTTAGG + Intergenic
958039521 3:88209240-88209262 TGTGGCATTCAGGTCCTTTTAGG + Intergenic
958767052 3:98381503-98381525 TGGGGCATACATAGCCTTTATGG + Intergenic
958882039 3:99683210-99683232 TGTAGAATATAGAGTCTTATGGG - Intronic
960483512 3:118222944-118222966 TATGCAATACAGAGCCAATTGGG + Intergenic
964559785 3:157981351-157981373 TGTGAAATACAGAGTCTTTATGG - Intergenic
964851451 3:161100638-161100660 TGTGGCATGCAGAATCTTTTAGG + Intronic
967403999 3:189096135-189096157 TGTGGTATGCAGAGCCTGCTGGG - Intronic
968884084 4:3317989-3318011 TTTGGAATGCAAAGCATTTTTGG + Exonic
969584424 4:8083872-8083894 TGTGGAAGAGGGAGCCTTTTGGG - Intronic
971484182 4:27142589-27142611 TGTGGAACACACAGCATGTTTGG - Intergenic
973615912 4:52677715-52677737 TGTGGAATGGATAGCCTTATGGG - Intergenic
975803873 4:78092138-78092160 AGTGGAAAAAAGAGACTTTTAGG + Intronic
976323814 4:83748385-83748407 TGCGGAATGCAGAGTCTATTTGG - Intergenic
977050752 4:92126441-92126463 TGTGGAAAACAGTAACTTTTTGG - Intergenic
977249745 4:94676598-94676620 TGAGGAATCCAGAGGCCTTTCGG - Intergenic
980057501 4:128093010-128093032 TGTAGAATCCAGAGCCTCTAAGG + Intronic
981941781 4:150288650-150288672 TGTGGAATGTACAGCCTTCTGGG - Intronic
986606690 5:9529805-9529827 TGTGGAATAAAAATCCTTTTTGG + Intronic
989059312 5:37394427-37394449 TGTGGATTACACAGTGTTTTAGG + Intronic
990094334 5:52092711-52092733 TTTGGAATAAAGAAACTTTTTGG + Intergenic
998547525 5:143043291-143043313 TATACAATACAGAACCTTTTGGG + Intronic
998814732 5:146001863-146001885 TGTGAAATACACAGACTTCTAGG + Intronic
999071505 5:148748357-148748379 TGTAGCATAGAGTGCCTTTTTGG - Intergenic
999232914 5:150072686-150072708 TGTGGAATACACAGGATTGTGGG + Intronic
1000190370 5:158904462-158904484 TTTGGGATACAGAGCCTTTCTGG + Intronic
1003653859 6:7987564-7987586 TGTGGAATACAGAGCCTTTTGGG - Intronic
1007455076 6:41970878-41970900 TGTGGAAAAAAGAGAATTTTGGG - Intronic
1010934284 6:81842455-81842477 TGTTGAACACACAGTCTTTTTGG + Intergenic
1012196638 6:96350278-96350300 TGAGAAATACAGGGTCTTTTGGG + Intergenic
1015603069 6:134929357-134929379 TGTGGAACACATAGTCTTGTGGG + Intronic
1016372713 6:143391477-143391499 TGTGGAATATGGAGCTGTTTGGG + Intergenic
1017252029 6:152290594-152290616 TGTGGAATGCTGTGCCTTTCTGG - Intronic
1018259390 6:161954339-161954361 TGTGGCATACAGAGCTTCTGTGG - Intronic
1018721848 6:166578962-166578984 TATAGAATGCAGAGGCTTTTTGG - Intronic
1021167143 7:17355164-17355186 TCAGGAAAACAGAGTCTTTTTGG - Intergenic
1021631665 7:22653134-22653156 TGTAGATTACATATCCTTTTTGG - Intergenic
1021784033 7:24134785-24134807 TGTCCAATACAGAGCCTTGCAGG - Intergenic
1022602882 7:31778344-31778366 TGTGGGACACAGAGGCATTTCGG - Intronic
1025101991 7:56143263-56143285 TGGAGATTACAAAGCCTTTTAGG - Intergenic
1029336711 7:99906552-99906574 TGTGGAATACAGAGCAATAAAGG + Intronic
1029528075 7:101107682-101107704 TGTGGTCCACAGAGCCTTCTAGG - Intergenic
1031687017 7:124743090-124743112 TTTAGAATACATAGCATTTTTGG - Intergenic
1035486789 7:159232454-159232476 TGTGGAATACAGAGCCCTTTGGG - Intergenic
1036007969 8:4688619-4688641 TGTTGACTTCAGAGCCATTTGGG + Intronic
1036080417 8:5549238-5549260 TGTGGAATAAACAACCTCTTTGG + Intergenic
1036603932 8:10289737-10289759 GGTGGAACACAGACACTTTTAGG + Intronic
1037161502 8:15778943-15778965 TGTGAATTAAATAGCCTTTTGGG - Intergenic
1037332442 8:17756693-17756715 TGTTGGAGACAGAGCCTTTAAGG + Intronic
1037437727 8:18881005-18881027 TGTGAAATACAGGTACTTTTTGG + Intronic
1041230675 8:55748047-55748069 TGAGGAATACTGAGCCTGCTAGG - Intronic
1044071172 8:87761971-87761993 TGTGGAATACAGAGCATTTGAGG - Intergenic
1050166420 9:2769454-2769476 TGTGGCATACATAGCCTCTGGGG + Intronic
1052550825 9:29946381-29946403 TATGGAATGCAGAGCATTTTTGG - Intergenic
1055130328 9:72767453-72767475 TTTTGCATGCAGAGCCTTTTGGG + Intronic
1058001516 9:99870595-99870617 TGTGGACTACAGAGCCTGAGTGG - Intergenic
1058254290 9:102742148-102742170 GGTGGAATACAGAGGCTTTTTGG - Intergenic
1059860921 9:118460469-118460491 TGTGAAATACAGGGCGGTTTGGG - Intergenic
1060507757 9:124210957-124210979 GGTGGAATACAGGGGATTTTGGG - Intergenic
1186169658 X:6863477-6863499 TGTGTAATACAGAACCTGTGAGG - Intergenic
1186185667 X:7017339-7017361 TGTGAAATACACAGACTTTATGG - Intergenic
1186546184 X:10451968-10451990 TGGGGTATACAGAACATTTTTGG - Intronic
1187758224 X:22548835-22548857 TGTGGAACAGAGAGCACTTTAGG + Intergenic
1188262490 X:28036874-28036896 TGTGGAATCCACAACCTTTTGGG - Intergenic
1190172451 X:48122269-48122291 TGTGTAATACAGAGCTATATTGG - Intergenic
1195078259 X:101347986-101348008 TGTGTAATACCAAGCCGTTTTGG - Intronic
1195296943 X:103488010-103488032 TGTTGACAACAGACCCTTTTGGG + Intergenic
1201560019 Y:15306055-15306077 TGTGTAATACAGAACCTGTGAGG - Intergenic