ID: 1072290501

View in Genome Browser
Species Human (GRCh38)
Location 10:93960471-93960493
Sequence GTGGAATACAGAGCCTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 3, 1: 1, 2: 1, 3: 16, 4: 205}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072290486_1072290501 24 Left 1072290486 10:93960424-93960446 CCATGGTGCCACCCCGTCGAGCC 0: 1
1: 1
2: 0
3: 6
4: 60
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205
1072290496_1072290501 -3 Left 1072290496 10:93960451-93960473 CCTGGATGGATTCCATGGCTGTG No data
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205
1072290493_1072290501 3 Left 1072290493 10:93960445-93960467 CCTCTCCCTGGATGGATTCCATG No data
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205
1072290495_1072290501 -2 Left 1072290495 10:93960450-93960472 CCCTGGATGGATTCCATGGCTGT No data
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205
1072290490_1072290501 12 Left 1072290490 10:93960436-93960458 CCCGTCGAGCCTCTCCCTGGATG No data
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205
1072290491_1072290501 11 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205
1072290487_1072290501 16 Left 1072290487 10:93960432-93960454 CCACCCCGTCGAGCCTCTCCCTG No data
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205
1072290489_1072290501 13 Left 1072290489 10:93960435-93960457 CCCCGTCGAGCCTCTCCCTGGAT No data
Right 1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG 0: 3
1: 1
2: 1
3: 16
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072290501 Original CRISPR GTGGAATACAGAGCCTTTTG GGG Intergenic
901950278 1:12739725-12739747 GTGGAAAACAGATGCTTTTGTGG + Intergenic
902091357 1:13906359-13906381 GAGAAATACAGAGCCTCCTGGGG + Intergenic
904698554 1:32344604-32344626 GGGGAATACACATACTTTTGGGG + Intergenic
907226520 1:52952219-52952241 GTACAATACATGGCCTTTTGTGG + Intronic
907718379 1:56949074-56949096 GTGGAATATAGACACATTTGGGG + Intronic
909286718 1:73828996-73829018 GTGGAAGACAGAAGATTTTGAGG - Intergenic
911007799 1:93244762-93244784 CTTGAATACAAAGCCTTATGTGG + Intronic
911351145 1:96756799-96756821 GTGGAGTACAGAGGATTTTAGGG + Intronic
911546308 1:99221888-99221910 GTGGAATAGAGAGCCTGAAGAGG + Intergenic
913204559 1:116525178-116525200 GTGGAACACAGAGGAGTTTGGGG - Intronic
914839513 1:151236681-151236703 GTGGAATACAGAGCCTTTTGGGG - Exonic
915772911 1:158448019-158448041 GTGGAACAGAAAGCCTTGTGGGG - Intergenic
916979430 1:170117055-170117077 TTGGATGACAGAGACTTTTGAGG - Intergenic
921428146 1:215029250-215029272 GTGAAATACAGAGAATTTTTAGG - Intronic
922228879 1:223668428-223668450 GTGGAGATCAGAGCCTTATGGGG - Intergenic
922637446 1:227188713-227188735 GTGGAACACAGAGCATTTTTAGG + Intronic
923107068 1:230862727-230862749 GTGGAACACAGAGAATTTTTAGG + Intronic
1063279717 10:4614021-4614043 GTGGAACACAGAGGATTTTTAGG - Intergenic
1070397576 10:76024924-76024946 GCGGAATGCAGAGCCTGGTGGGG - Intronic
1070650225 10:78229950-78229972 GAGAAATACAGAGCCCTCTGCGG - Intergenic
1071056100 10:81509768-81509790 GTGGAATGCAGAGGATTTTTAGG - Intergenic
1072075448 10:91968172-91968194 GTGGAACACAGGGGATTTTGGGG - Intronic
1072290501 10:93960471-93960493 GTGGAATACAGAGCCTTTTGGGG + Intergenic
1072936519 10:99718489-99718511 TTGGAATACAGGGGCTTTTGTGG - Exonic
1073091485 10:100943799-100943821 TTGGCATAAAGAGACTTTTGAGG + Intronic
1073638527 10:105224212-105224234 GTGGAGCACAGAGCATTTTCAGG - Intronic
1073848860 10:107591259-107591281 AGGGATTACAAAGCCTTTTGTGG - Intergenic
1075223406 10:120603555-120603577 GTAGAACAAAGAGCCTTGTGAGG + Intergenic
1077810910 11:5635585-5635607 ATAGAATATTGAGCCTTTTGGGG + Intronic
1079980597 11:27147705-27147727 GTGGAACACAGAGGATTTTTAGG + Intergenic
1080684165 11:34501846-34501868 GTGGAATACTCAGCCTATTTAGG - Intronic
1081704732 11:45175264-45175286 GTGGAATATAGAGGATTTTTAGG - Intronic
1082598484 11:55115897-55115919 GGATATTACAGAGCCTTTTGAGG - Intergenic
1082869686 11:57932517-57932539 TTGGTCTGCAGAGCCTTTTGAGG - Intergenic
1084248661 11:67878666-67878688 GAGAAATACAGAAGCTTTTGTGG - Intergenic
1085820171 11:79783932-79783954 GGGGAATAAAGAGGCTTGTGTGG - Intergenic
1088225052 11:107610846-107610868 ATGGAATACAGAGCCCTTTCAGG - Intronic
1089745345 11:120613031-120613053 CTGGGATAAAGAGCCATTTGAGG + Intronic
1091679208 12:2514437-2514459 TTGGAATACAGGGCCTTTGATGG + Intronic
1091684956 12:2555099-2555121 GTGGACTACAGGTCCTTCTGTGG - Intronic
1091712372 12:2751080-2751102 GTAGAAAACAGCGTCTTTTGGGG + Intergenic
1092293016 12:7175553-7175575 GTGGAAGACAGAGCATTTTTAGG - Intergenic
1093114755 12:15195471-15195493 CTGGAATACATAATCTTTTGTGG - Intronic
1093420193 12:18966198-18966220 TTGGAATTCAGAGACCTTTGGGG - Intergenic
1093688156 12:22079492-22079514 GTGAAAAATAAAGCCTTTTGTGG + Intronic
1096307083 12:50487335-50487357 GTGGAACACAGAGGATTTTCAGG + Intergenic
1096935815 12:55274174-55274196 GTGGTATACAGTTACTTTTGAGG + Intergenic
1101106812 12:101448630-101448652 GTGGAACACAGAGGATTTTTCGG + Intergenic
1101125551 12:101630008-101630030 GTGGAATATAGGGTCTTTTTGGG - Intronic
1104267265 12:127245130-127245152 GTAGAAAACAGAACCTCTTGAGG - Intergenic
1106790324 13:33149072-33149094 GTGGAACACAGAGGATTTTTAGG + Intronic
1109459733 13:62640919-62640941 GTTGAATTCACACCCTTTTGTGG - Intergenic
1109662874 13:65488472-65488494 GTGGTATACAGGGCATTTTTAGG + Intergenic
1110979500 13:81877682-81877704 GTGGAATAAATAGCACTTTGAGG + Intergenic
1112371330 13:98796327-98796349 GTGGAAGCCAGGGCCGTTTGTGG - Intronic
1115218736 14:31038068-31038090 GTAGAACACAGAGACTTTTCAGG - Intronic
1115481108 14:33862106-33862128 GTGGAATCCAGGACCTTTTAGGG - Intergenic
1116504089 14:45656672-45656694 GTGGAGCACAGAGCATCTTGAGG - Intergenic
1117226076 14:53660549-53660571 GTGGAATATAGAGAATTTTTAGG - Intergenic
1117608984 14:57463316-57463338 GTGGAACACAGAGGATTTTTAGG - Intergenic
1118534761 14:66748981-66749003 GTAGAATACAGAGGATTTTTAGG - Intronic
1119836796 14:77757608-77757630 GTGGTATGTAGAGCGTTTTGGGG - Intronic
1121819612 14:96955673-96955695 GTGGAGTTCAGGGGCTTTTGAGG + Intergenic
1124402821 15:29365044-29365066 GTGGAACACAGAGGATTTTCAGG - Intronic
1125995759 15:44159345-44159367 ATGGAATACAAAGCCCTTTATGG - Intronic
1126043395 15:44615239-44615261 GAGGAATACTGATCTTTTTGAGG - Intronic
1127184845 15:56467344-56467366 GTAGAACACAGAGACTTTTTAGG - Intergenic
1127641726 15:60922190-60922212 GTGGAGCACAGAGGATTTTGAGG + Intronic
1127841175 15:62833442-62833464 TTGGAAGAAAGAGCCCTTTGTGG + Intronic
1129083504 15:73063670-73063692 GTAAAATACAGAGCATTATGAGG + Intronic
1131451562 15:92544486-92544508 GTGGAACACAGAGAATTTTTAGG + Intergenic
1131988127 15:98065563-98065585 GTGAAATCCAGAGCAATTTGTGG - Intergenic
1132436794 15:101812511-101812533 GTGGTATCCAGAGACTTTTGGGG + Intronic
1132490525 16:227496-227518 GTGGAATACACATTTTTTTGAGG + Intronic
1133308427 16:4826606-4826628 GTTGAATGCAGAGGTTTTTGGGG + Intronic
1137475777 16:48809282-48809304 GTGGAGTATAGAGAATTTTGAGG + Intergenic
1138964623 16:62069194-62069216 GTGGAACACAGAGGATTTTTGGG - Intergenic
1139190404 16:64856777-64856799 GTGGAACACAGAGGATTTTTAGG + Intergenic
1140740239 16:77935088-77935110 GTGGAATAAAGTGCATTTTGTGG - Intronic
1153149026 18:2068758-2068780 GTGGAACACAGAACTTTTTGGGG - Intergenic
1153403609 18:4709023-4709045 GTGGAATACAGAGAATTTTGGGG + Intergenic
1155812679 18:30258247-30258269 GTGGAGTACAGAGGATTTTTAGG - Intergenic
1156136611 18:34047591-34047613 GTGGATTAAAGTGTCTTTTGAGG + Intronic
1156889074 18:42169100-42169122 TTGGAATGCAGAGACTTTTAAGG - Intergenic
1157649785 18:49316679-49316701 GTAGAGCACAGAGCATTTTGGGG - Intronic
1159495191 18:69193764-69193786 GTGGAACACAGAGGATTTTAAGG + Intergenic
1159993406 18:74937937-74937959 GTGGAAGACAGAGCATTTCCAGG - Intronic
1160872663 19:1284205-1284227 CTGGGCTACAGAGCCTTGTGTGG + Intergenic
1161078997 19:2301068-2301090 GTGGGATGCAGAGTCTCTTGGGG - Intronic
1163130777 19:15271519-15271541 GTGGAACCCAGAGCGTTGTGAGG - Intronic
1163648284 19:18502563-18502585 GTGGATTACTGGGACTTTTGTGG - Intronic
1164955649 19:32381232-32381254 GTGGAGTACAGGGCATTTTTAGG + Intronic
1166078870 19:40430743-40430765 GTGGAAAACAGGATCTTTTGGGG - Intergenic
1167975085 19:53219731-53219753 GTGGAGCACAGAGGATTTTGAGG - Intergenic
1168216333 19:54928769-54928791 GTGGCCTACAGGGCCTTATGGGG - Intronic
926837793 2:17043724-17043746 TTGGAATGCAGTGCCTTTGGTGG + Intergenic
927689200 2:25195708-25195730 GTGGAATGCAGACCCTGTTGAGG - Intergenic
930635627 2:53802651-53802673 GTGTAATACAAACCCCTTTGTGG + Intronic
930762655 2:55052076-55052098 GTGGAACACAGAAGATTTTGGGG + Intronic
932510719 2:72286512-72286534 GTGGAGTACAGAGGATTTTAGGG + Intronic
936754068 2:115683359-115683381 GTGGAACACACAGAATTTTGGGG + Intronic
937197737 2:120174747-120174769 GTGCCACACAGAGCATTTTGAGG - Intronic
937395630 2:121531889-121531911 GTGAAATAGTGAGCTTTTTGTGG + Intronic
939619313 2:144399000-144399022 GGGTAATAAAGAGTCTTTTGTGG + Exonic
939808169 2:146800481-146800503 GTGGAAAACACAGCATTTTTGGG + Intergenic
940832692 2:158485099-158485121 GTGGTCTACAAGGCCTTTTGTGG + Intronic
941774436 2:169376537-169376559 CTGGAATTCAGAGCCTAATGAGG - Intergenic
944086723 2:195856677-195856699 GTGAAATAAGGAGCCTTTTTTGG - Intronic
944161008 2:196659948-196659970 GTGGAACACAGGGCATTTTTAGG - Intronic
948131979 2:235607674-235607696 GTGGAATCCAGAGACCTTGGTGG - Intronic
948627886 2:239280375-239280397 GAGGAATACAGAGCTGTTTCTGG + Intronic
948702793 2:239770816-239770838 GGGGAACACTGAGCCCTTTGTGG - Intronic
1170071832 20:12377612-12377634 GAGGAAAACAGAGCCTTTGGAGG + Intergenic
1170754204 20:19184316-19184338 GTGGAACACAGAGGATTTTTAGG - Intergenic
1173708107 20:45128916-45128938 GTGAAATACTGTGGCTTTTGAGG + Intergenic
1175438135 20:58969528-58969550 TGGCAATACAGAGTCTTTTGTGG - Intergenic
1175721383 20:61289591-61289613 TTGGATTAAAGAGCCCTTTGAGG + Intronic
1175973246 20:62697790-62697812 TTGGAATAAAGAGCCCATTGTGG - Intergenic
1177691011 21:24507478-24507500 TTGGGATACAGAGACTTTTCTGG - Intergenic
1177694262 21:24552131-24552153 ATGAAATACAGACCCTATTGTGG - Intergenic
1184393788 22:44220769-44220791 GTGGCATCAAGAGCCTTGTGGGG + Intergenic
949327918 3:2888111-2888133 GTGAAATAAATAGACTTTTGTGG - Intronic
949451321 3:4188425-4188447 GTGGAACACAGAGGATTTTTAGG - Intronic
949744872 3:7278793-7278815 TTGGAATACAGAGACTTCTCAGG + Intronic
950844848 3:16005150-16005172 ATGTAATACATGGCCTTTTGTGG + Intergenic
951079816 3:18440220-18440242 GTGGCATGCAGATTCTTTTGGGG + Intronic
952670663 3:35963447-35963469 GTGTGATACAGAACATTTTGAGG + Intergenic
956404035 3:68909521-68909543 GGGGAATTCATAGTCTTTTGAGG - Intronic
958146125 3:89627923-89627945 GTGGAACACAGATCATTTTGAGG + Intergenic
958221275 3:90684690-90684712 GTGGCATTTAGAGCCGTTTGAGG - Intergenic
958882038 3:99683209-99683231 GTAGAATATAGAGTCTTATGGGG - Intronic
960374347 3:116879834-116879856 GTGCAATTTAGAGCCTTTTCAGG - Intronic
960483513 3:118222945-118222967 ATGCAATACAGAGCCAATTGGGG + Intergenic
961852603 3:129836834-129836856 CTGCATTAGAGAGCCTTTTGAGG - Intronic
962241944 3:133757233-133757255 GAGCAATACAGAGCCTCTTCAGG - Intronic
962725561 3:138223306-138223328 GTGGACTGCACAGCCTTTTTTGG + Intronic
963798394 3:149654254-149654276 CTGAAATACACTGCCTTTTGAGG + Intronic
965826380 3:172735152-172735174 GTGGAACACAGAGGATTTTTAGG - Intergenic
965983904 3:174727848-174727870 GTGGAACACAGAGGATTTTTAGG - Intronic
966647327 3:182261107-182261129 ACGGGTTACAGAGCCTTTTGAGG + Intergenic
969584423 4:8083871-8083893 GTGGAAGAGGGAGCCTTTTGGGG - Intronic
971741922 4:30532518-30532540 GTGGGATACAGGGAATTTTGGGG - Intergenic
972229935 4:37060073-37060095 TTGGAAAATAAAGCCTTTTGAGG + Intergenic
973615911 4:52677714-52677736 GTGGAATGGATAGCCTTATGGGG - Intergenic
975131970 4:70839889-70839911 GTGGAATCCAGGGCCGGTTGGGG + Exonic
976906931 4:90249118-90249140 GTGGAATACAGTACTATTTGAGG - Intronic
978281653 4:107023501-107023523 GTGGAACACAGAGGATTTTTAGG + Intronic
978528570 4:109691721-109691743 TTGGAAGACAGGGCCTTTAGAGG + Intronic
978718728 4:111878238-111878260 GTGGAAAACAAGGACTTTTGAGG + Intergenic
979926772 4:126577418-126577440 GTGGAGTATAGGGCATTTTGGGG - Intergenic
980734821 4:136870899-136870921 GAGGAATACAGAGTCCTTGGTGG + Intergenic
981088717 4:140710611-140710633 CTGGAAGACATGGCCTTTTGAGG - Intronic
981941780 4:150288649-150288671 GTGGAATGTACAGCCTTCTGGGG - Intronic
982682430 4:158447406-158447428 GTGGAATACAGAGACGGTGGTGG + Intronic
987808368 5:22800671-22800693 GTGGTATACAGAGGATTTTTAGG - Intronic
988812447 5:34798843-34798865 GTGGAATCCACAGCACTTTGGGG + Intronic
990528621 5:56652515-56652537 GTGGAGGACAGAGGATTTTGAGG + Intergenic
995247465 5:109950687-109950709 GTAGAAGACAGAGTCTTCTGGGG + Intergenic
995259186 5:110081990-110082012 GTGGATTACAGTGTCATTTGAGG - Intergenic
997891393 5:137680104-137680126 CTGGAATACAAAGTCTTCTGGGG - Intronic
998616575 5:143747150-143747172 ATGGGATACAGGGCCTTTTGTGG - Intergenic
999980554 5:156953775-156953797 GTGGAATACAGAGCTCATTTTGG + Intronic
1000506989 5:162133218-162133240 GTGGTACATAGAGCTTTTTGAGG - Intronic
1000910240 5:167013164-167013186 GTGGAAGAGAGAGCCTTATCAGG + Intergenic
1003337950 6:5192701-5192723 ACGGAATACACAGCCTGTTGTGG - Intronic
1003653858 6:7987563-7987585 GTGGAATACAGAGCCTTTTGGGG - Intronic
1003882498 6:10491256-10491278 ATGGAATTCAGAGCCTCTAGTGG + Intergenic
1005862258 6:29910865-29910887 GTGGTGTTCAGAGCCTTGTGGGG - Intergenic
1006710785 6:36068381-36068403 GTAAAATAGGGAGCCTTTTGAGG + Intronic
1007455075 6:41970877-41970899 GTGGAAAAAAGAGAATTTTGGGG - Intronic
1007972350 6:46065780-46065802 AGGTAAGACAGAGCCTTTTGAGG + Intronic
1008444695 6:51574453-51574475 GTGGAACACAGAGGATTTTTAGG + Intergenic
1008740715 6:54604140-54604162 GTGGAACACAGAACATTTTTAGG - Intergenic
1011577656 6:88821435-88821457 GTGAAATATAGGGCATTTTGAGG + Intronic
1011786858 6:90856353-90856375 GAGGAATTCAGACTCTTTTGGGG + Intergenic
1011868565 6:91862527-91862549 GTGGAATACAGAGCATACAGGGG - Intergenic
1012196639 6:96350279-96350301 GAGAAATACAGGGTCTTTTGGGG + Intergenic
1015686712 6:135871332-135871354 GTGGGTTACACAGGCTTTTGTGG - Intronic
1016056935 6:139587845-139587867 GTGGAATAGAGTGCTTGTTGTGG - Intergenic
1016372714 6:143391478-143391500 GTGGAATATGGAGCTGTTTGGGG + Intergenic
1017360158 6:153559346-153559368 GTGGAATTCAGAAGCTGTTGGGG - Intergenic
1019166274 6:170099625-170099647 GTGGAAAACACAGGCTTTTCTGG - Intergenic
1022578723 7:31525751-31525773 GTGGAACATAGAGCAATTTGGGG + Intronic
1024171824 7:46795878-46795900 GTGAAATACAGGGCATTTTTTGG - Intergenic
1024525690 7:50347227-50347249 GTTAAAAACAGAGCCTTTTTTGG + Intronic
1028349389 7:89826339-89826361 CTGGAATACAGACCCTTGTAAGG + Intergenic
1030859015 7:114600146-114600168 GTGGAATACAGGGGATTTTTAGG - Intronic
1031713434 7:125077386-125077408 ATGGTATAATGAGCCTTTTGTGG - Intergenic
1033439219 7:141363660-141363682 GTGGAAAACAGAGAGTTCTGTGG + Intronic
1033937034 7:146598945-146598967 CTGGAACAAAGAGGCTTTTGGGG - Intronic
1034783242 7:153901386-153901408 GTGCAATATAGAGTCTTCTGCGG + Intronic
1035486788 7:159232453-159232475 GTGGAATACAGAGCCCTTTGGGG - Intergenic
1035945817 8:3961139-3961161 GTGAAATACAGAGACTATTATGG - Intronic
1036007970 8:4688620-4688642 GTTGACTTCAGAGCCATTTGGGG + Intronic
1036236668 8:7044954-7044976 GTGTAACACAGAGCCCATTGTGG + Intergenic
1036499458 8:9299962-9299984 GTGTAATCTACAGCCTTTTGGGG + Intergenic
1037651554 8:20843554-20843576 TTGGAATGCAGAGCTTTGTGGGG + Intergenic
1039578195 8:38642648-38642670 GTGGAGTACAGAGGGTTTTTAGG + Intergenic
1040662994 8:49597139-49597161 GTGGAACACAGAGGATTTTTAGG + Intergenic
1044225621 8:89714680-89714702 GTAGAATGCAGAGACTGTTGGGG + Intergenic
1044507972 8:93042579-93042601 CTGGGATACAGAGCATTTTGAGG - Intergenic
1045167534 8:99623648-99623670 GACCAATACAGAGCCTTATGTGG + Intronic
1045370124 8:101514723-101514745 GTGGAATGAAGAGCTTTTTCAGG + Intronic
1045693204 8:104780568-104780590 GTGCAATAAAGAGCCCTTTGAGG - Intronic
1047347059 8:124038833-124038855 GTGGTATACAGAAGCTCTTGTGG - Intronic
1047405181 8:124579250-124579272 ATGTAGTACACAGCCTTTTGAGG - Intronic
1049913160 9:289945-289967 GTGGAACACAGAGGATTTTTAGG - Intronic
1050462645 9:5890139-5890161 TTGGATTTCAGATCCTTTTGTGG + Intronic
1052251802 9:26407469-26407491 GGGGAATTCACAGCCTGTTGAGG + Intergenic
1052550824 9:29946380-29946402 ATGGAATGCAGAGCATTTTTGGG - Intergenic
1055130329 9:72767454-72767476 TTTGCATGCAGAGCCTTTTGGGG + Intronic
1057123829 9:92600729-92600751 TTGGAATAGAGAGGCTTTTCTGG + Intronic
1060507756 9:124210956-124210978 GTGGAATACAGGGGATTTTGGGG - Intergenic
1061012918 9:127966001-127966023 GGGGAACAAAGAGCGTTTTGGGG - Intronic
1186215976 X:7301685-7301707 GCGGAACACAGAGGATTTTGGGG - Intronic
1188294160 X:28425994-28426016 GTGGAGGAGAGAGCCCTTTGGGG - Intergenic
1189425593 X:40897213-40897235 GTGGATGACACTGCCTTTTGTGG + Intergenic
1190254817 X:48754469-48754491 TTGGAATGTAGAGCCTCTTGGGG - Intergenic
1190724563 X:53180293-53180315 GTGGAACACAGAGGATTTTTAGG + Intergenic
1192836047 X:74800942-74800964 GTGGAGCACAGAGCATTTTTAGG - Intronic
1198212801 X:134530928-134530950 GTGGCATACAGAGCCTGAGGAGG - Intergenic
1199028591 X:142970945-142970967 GGGGAATTCAGGGTCTTTTGTGG - Intergenic
1201859956 Y:18585966-18585988 GTGGAATACAGAAACCTCTGTGG + Intronic
1201873365 Y:18734415-18734437 GTGGAATACAGAAACCTCTGTGG - Intronic
1202033943 Y:20611981-20612003 TAGAAATACAGGGCCTTTTGAGG + Intergenic
1202601987 Y:26602534-26602556 GAGGAGTACACAGCCATTTGAGG - Intergenic