ID: 1072290503

View in Genome Browser
Species Human (GRCh38)
Location 10:93960473-93960495
Sequence GGAATACAGAGCCTTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072290496_1072290503 -1 Left 1072290496 10:93960451-93960473 CCTGGATGGATTCCATGGCTGTG No data
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data
1072290495_1072290503 0 Left 1072290495 10:93960450-93960472 CCCTGGATGGATTCCATGGCTGT No data
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data
1072290486_1072290503 26 Left 1072290486 10:93960424-93960446 CCATGGTGCCACCCCGTCGAGCC 0: 1
1: 1
2: 0
3: 6
4: 60
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data
1072290493_1072290503 5 Left 1072290493 10:93960445-93960467 CCTCTCCCTGGATGGATTCCATG No data
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data
1072290489_1072290503 15 Left 1072290489 10:93960435-93960457 CCCCGTCGAGCCTCTCCCTGGAT No data
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data
1072290491_1072290503 13 Left 1072290491 10:93960437-93960459 CCGTCGAGCCTCTCCCTGGATGG No data
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data
1072290487_1072290503 18 Left 1072290487 10:93960432-93960454 CCACCCCGTCGAGCCTCTCCCTG No data
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data
1072290490_1072290503 14 Left 1072290490 10:93960436-93960458 CCCGTCGAGCCTCTCCCTGGATG No data
Right 1072290503 10:93960473-93960495 GGAATACAGAGCCTTTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072290503 Original CRISPR GGAATACAGAGCCTTTTGGG GGG Intergenic
No off target data available for this crispr