ID: 1072290767

View in Genome Browser
Species Human (GRCh38)
Location 10:93962249-93962271
Sequence GGTACAGTGTAAGGTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072290767_1072290772 15 Left 1072290767 10:93962249-93962271 CCTGCAGCACCTTACACTGTACC No data
Right 1072290772 10:93962287-93962309 GCCCAGTGAATATTTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072290767 Original CRISPR GGTACAGTGTAAGGTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr