ID: 1072290772

View in Genome Browser
Species Human (GRCh38)
Location 10:93962287-93962309
Sequence GCCCAGTGAATATTTCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072290769_1072290772 6 Left 1072290769 10:93962258-93962280 CCTTACACTGTACCTGGCACACA No data
Right 1072290772 10:93962287-93962309 GCCCAGTGAATATTTCTGAATGG No data
1072290771_1072290772 -6 Left 1072290771 10:93962270-93962292 CCTGGCACACAGGAGATGCCCAG No data
Right 1072290772 10:93962287-93962309 GCCCAGTGAATATTTCTGAATGG No data
1072290767_1072290772 15 Left 1072290767 10:93962249-93962271 CCTGCAGCACCTTACACTGTACC No data
Right 1072290772 10:93962287-93962309 GCCCAGTGAATATTTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072290772 Original CRISPR GCCCAGTGAATATTTCTGAA TGG Intergenic
No off target data available for this crispr