ID: 1072291437

View in Genome Browser
Species Human (GRCh38)
Location 10:93969235-93969257
Sequence CAAGCACATACAACCACGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072291437_1072291441 4 Left 1072291437 10:93969235-93969257 CCGGGCGTGGTTGTATGTGCTTG No data
Right 1072291441 10:93969262-93969284 CCCAGCTACTCAGGAGGCTGAGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870
1072291437_1072291438 -5 Left 1072291437 10:93969235-93969257 CCGGGCGTGGTTGTATGTGCTTG No data
Right 1072291438 10:93969253-93969275 GCTTGTAGTCCCAGCTACTCAGG 0: 1783
1: 78929
2: 200471
3: 241263
4: 176852
1072291437_1072291445 29 Left 1072291437 10:93969235-93969257 CCGGGCGTGGTTGTATGTGCTTG No data
Right 1072291445 10:93969287-93969309 GGAGAATCACTTGAACCCGGAGG 0: 443
1: 2693
2: 5624
3: 7981
4: 9007
1072291437_1072291444 26 Left 1072291437 10:93969235-93969257 CCGGGCGTGGTTGTATGTGCTTG No data
Right 1072291444 10:93969284-93969306 GCAGGAGAATCACTTGAACCCGG 0: 33779
1: 81745
2: 101616
3: 124160
4: 74442
1072291437_1072291443 8 Left 1072291437 10:93969235-93969257 CCGGGCGTGGTTGTATGTGCTTG No data
Right 1072291443 10:93969266-93969288 GCTACTCAGGAGGCTGAGGCAGG 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
1072291437_1072291439 -2 Left 1072291437 10:93969235-93969257 CCGGGCGTGGTTGTATGTGCTTG No data
Right 1072291439 10:93969256-93969278 TGTAGTCCCAGCTACTCAGGAGG 0: 40849
1: 157871
2: 218647
3: 208196
4: 128589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072291437 Original CRISPR CAAGCACATACAACCACGCC CGG (reversed) Intergenic
No off target data available for this crispr