ID: 1072295843

View in Genome Browser
Species Human (GRCh38)
Location 10:94008924-94008946
Sequence GAACCATGGATGGGTGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072295837_1072295843 2 Left 1072295837 10:94008899-94008921 CCGTGTGTATGGGTTTTGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1072295843 10:94008924-94008946 GAACCATGGATGGGTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072295843 Original CRISPR GAACCATGGATGGGTGCTAG AGG Intronic
No off target data available for this crispr