ID: 1072296103

View in Genome Browser
Species Human (GRCh38)
Location 10:94010847-94010869
Sequence CAAAATACTGATAGAAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 11, 2: 23, 3: 112, 4: 632}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072296103 Original CRISPR CAAAATACTGATAGAAATAT GGG (reversed) Intronic
900007440 1:71781-71803 CAAAATATTAATAGGAAAATGGG + Intergenic
902671406 1:17976927-17976949 AAAAAGAAAGATAGAAATATGGG - Intergenic
904777935 1:32923152-32923174 CATAATGCTGCTATAAATATTGG - Intergenic
904796368 1:33059285-33059307 CAAAACCTTGATAGGAATATGGG + Intronic
905065297 1:35175858-35175880 CAGAATACTGATGGGAATGTTGG - Intergenic
905572931 1:39020388-39020410 CATAGTACTGATATAAAAATAGG - Intergenic
906028957 1:42701275-42701297 CAAAATACTCATGAAAATACAGG - Intronic
906080484 1:43084944-43084966 CCTAAAACTGCTAGAAATATGGG - Intergenic
906617345 1:47242425-47242447 CAATATACTGATTCAAATCTTGG - Intergenic
906739359 1:48167030-48167052 CAAATTACTTTAAGAAATATGGG + Intergenic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907711120 1:56882585-56882607 CAAAATACTGACAGAAAATAAGG + Intronic
907755935 1:57310835-57310857 GAAAATACAGATAGAGAGATGGG + Intronic
908094799 1:60726208-60726230 AAAAAAACTAATAGAAATGTTGG - Intergenic
908591592 1:65642676-65642698 AAAAATCCTAATAGAAAAATAGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909039698 1:70634453-70634475 CAAAATAATGATAGATGTAGTGG - Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
909860483 1:80598795-80598817 CATAGTACTGATATAAAAATAGG + Intergenic
909900948 1:81134581-81134603 CAAAATACTGATTAATATAAAGG - Intergenic
909957563 1:81799571-81799593 CAAAATACTGATAGGTATTTAGG + Intronic
910204310 1:84732718-84732740 CAAAAAACAAACAGAAATATTGG - Intergenic
911868533 1:103060483-103060505 CAAAATAATAATAGCAATAATGG + Intronic
912108864 1:106315425-106315447 AAAAATAAGAATAGAAATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912578587 1:110699414-110699436 CAAAAACCTGATGGAAAAATGGG + Intergenic
914906123 1:151746326-151746348 CAAATTAATAATAGAAAGATAGG - Intergenic
915779060 1:158525370-158525392 CAAAATCATGAAAGACATATTGG + Intergenic
916156437 1:161854458-161854480 CAAACTACTGTTAGAAAGACTGG + Intronic
916326546 1:163566572-163566594 TAAAATACTAATAGGAAAATTGG - Intergenic
917812155 1:178669815-178669837 AAATATACTCATAAAAATATTGG - Intergenic
917990746 1:180375996-180376018 CAAAAACCTGATAGAAAAATGGG + Intronic
918563624 1:185899213-185899235 TATAGTACTGATAGAAATTTGGG - Intronic
918781446 1:188704850-188704872 CAAAAATCTGATAAAAATATAGG - Intergenic
919219677 1:194610426-194610448 CACAATATTGCTAGAAATAAGGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920790863 1:209089900-209089922 CAAAATGCTTAAAGAAATAATGG + Intergenic
921464174 1:215465592-215465614 TAATAAAATGATAGAAATATTGG - Intergenic
922782136 1:228261163-228261185 CAAAATAATGATAATAATAATGG - Intronic
923071994 1:230574121-230574143 CAAAATTCTGACATGAATATGGG + Intergenic
923837191 1:237625235-237625257 CAAAATACTGCTAAAATTTTTGG + Intronic
923859042 1:237874545-237874567 CAAAAGACAGATACAAGTATTGG + Intergenic
924273302 1:242357804-242357826 AAACATATTGAAAGAAATATTGG - Intronic
924280122 1:242428664-242428686 CAAAGTACTGAAAAAAATATAGG - Intronic
1062808632 10:444743-444765 CAAAATACTGAAACCAAAATAGG - Intronic
1062958634 10:1556900-1556922 AAAAATAGTGATAGGAATAGAGG - Intronic
1063166133 10:3464173-3464195 CCATATATTGATAGAAATAGGGG + Intergenic
1063400252 10:5736843-5736865 CAGAAAACTCATAGAAAGATAGG - Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066711421 10:38238848-38238870 AAACATATTGAAAGAAATATTGG + Intergenic
1066753265 10:38682139-38682161 CATAATACTGGTATAAAAATAGG + Intergenic
1067049676 10:43006694-43006716 AAAAATACTCATCCAAATATTGG - Intergenic
1067366848 10:45639385-45639407 CCAAATACTGGTAAGAATATGGG + Intronic
1067446062 10:46347105-46347127 CACAGTACTGATATAAAAATAGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068358971 10:55951181-55951203 CAAAAGACAAATAGATATATAGG + Intergenic
1068468354 10:57426082-57426104 AAAAAGACATATAGAAATATAGG - Intergenic
1068528367 10:58156975-58156997 TAAAATAGTGATATAAATTTAGG + Intergenic
1070107957 10:73454475-73454497 CCAAATAGTGACAGAAATGTTGG - Exonic
1070196039 10:74157319-74157341 AAAAAATCTGATGGAAATATGGG + Intronic
1071448124 10:85768457-85768479 CAATATTCTGATGAAAATATTGG + Intronic
1071925341 10:90400995-90401017 GAAAATATTAATAGAAATATTGG - Intergenic
1072120187 10:92399310-92399332 AAAAATACTGAAAGAAATCAGGG + Intergenic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072510612 10:96120058-96120080 CAGAAGAAAGATAGAAATATTGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1074730609 10:116370028-116370050 CAAAAGCCTGATAGAAAAATGGG - Intronic
1076457702 10:130612805-130612827 CCAAAAACTGAGAGAAATATAGG - Intergenic
1076498024 10:130911570-130911592 AAAAATACTCAAAGAAATAATGG - Intergenic
1077267393 11:1658244-1658266 CAAAATCTTTGTAGAAATATGGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078332203 11:10433170-10433192 CAAAATCCTCATAAAAATACCGG + Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079255577 11:18825807-18825829 CATGATACTGATATAAAAATAGG - Intergenic
1079555656 11:21755604-21755626 CATGATACTGATACAAATACAGG - Intergenic
1079706411 11:23626153-23626175 CAAAGTAATGATTGATATATAGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079758631 11:24299621-24299643 AATAATTCTGATAGATATATTGG + Intergenic
1079921418 11:26437839-26437861 AAAAATCCTAATAAAAATATTGG + Intronic
1080052550 11:27871795-27871817 CAAAATACTAGGAGAAATAGAGG + Intergenic
1080133332 11:28822660-28822682 CCAAATAAAGATAGACATATTGG + Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080376733 11:31722039-31722061 GAAAATACTGATTGATATTTTGG + Intronic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081072090 11:38623989-38624011 CCAGATACTGATTCAAATATTGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1081129306 11:39358104-39358126 CCAAATAATGAGAAAAATATTGG - Intergenic
1081368845 11:42273233-42273255 GAAAATATTGATAGTAATTTTGG + Intergenic
1081564024 11:44245289-44245311 CAAAAGAATGAGAGAAATTTTGG - Exonic
1081960800 11:47135445-47135467 CAGAACACTGATAGGCATATGGG - Intronic
1082625933 11:55485505-55485527 CAAATTACTGATTGAATTAAGGG + Intergenic
1082674032 11:56073405-56073427 CACAATTCTGATAGAAATTGAGG + Intergenic
1082704292 11:56474411-56474433 CCAAATACTGTTATAAATACTGG - Intergenic
1082708086 11:56518321-56518343 CAAAGTGCTGGTAGAAATAGGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082977826 11:59091980-59092002 CAATGAACTAATAGAAATATCGG - Intergenic
1083313709 11:61800935-61800957 TATTATACTGATAGGAATATAGG + Exonic
1083536708 11:63475285-63475307 GCAAAAACTGATAGAAATAAAGG - Intronic
1085856306 11:80180251-80180273 AAAAAAACTCAGAGAAATATAGG - Intergenic
1086488834 11:87338016-87338038 AAAAATACTGGAAGAAATAATGG + Intergenic
1086579164 11:88376807-88376829 AAAAATACTCAAAGAAATAATGG - Intergenic
1086862023 11:91935429-91935451 AAAAATACTGATAGGAATAGGGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087349753 11:97016836-97016858 AAAAATACAGATGAAAATATTGG + Intergenic
1087392399 11:97554258-97554280 CAAAATATTGTTAGTATTATTGG - Intergenic
1087393393 11:97567785-97567807 AAAAAAAAAGATAGAAATATTGG + Intergenic
1087741619 11:101894123-101894145 CAGAATACTGATAGAACTTTTGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088197058 11:107286182-107286204 TAAAAAACTGATAGAAAGGTTGG + Intergenic
1088826460 11:113498672-113498694 CCAAAACCTGATAGAAATATTGG + Intergenic
1088838931 11:113606185-113606207 CAAAAAACAGGTAGAAATGTGGG - Intergenic
1090122431 11:124046061-124046083 AAAAGTACTGTTAGAAAAATAGG - Intergenic
1090575024 11:128092805-128092827 CAAAATATAGATATAAAAATTGG - Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092936713 12:13370835-13370857 CAAATTACAGCTAGAAAGATGGG - Intergenic
1093266134 12:17005962-17005984 CAATAAACTGATACAAGTATTGG - Intergenic
1093556351 12:20479428-20479450 GAAAACACTGAAAGAAATTTAGG - Intronic
1093768896 12:22997318-22997340 AATAATAGTGATAGAAATAATGG - Intergenic
1094348998 12:29502407-29502429 CAAAATAAAGATAGAGATGTAGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094537005 12:31330281-31330303 CAAAATTCTCAAAGAAAAATCGG + Intergenic
1095067589 12:37798791-37798813 CAAACTGCTGAAAGAAATAAAGG - Intergenic
1095091036 12:38105538-38105560 CATGATACTGATACAAATACAGG - Intergenic
1095199659 12:39368558-39368580 AAACATATTGATAGAAAAATAGG - Intronic
1095254991 12:40024088-40024110 CAGAATCCTGATAGAGACATAGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095419606 12:42011609-42011631 CAAAATATTGATAGAAGAAAAGG + Intergenic
1095564625 12:43607944-43607966 TAAAATACTGATAAAACTAAAGG - Intergenic
1095772097 12:45971396-45971418 CAAAATACTGACAGAATGAATGG + Intronic
1096332042 12:50722117-50722139 CAAAATTCTGGGTGAAATATTGG + Intronic
1096474867 12:51902386-51902408 CAAAATAATAATAAAAATTTAGG + Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097208484 12:57345253-57345275 TGAAATACTGAAAGAAATAATGG + Intronic
1097349402 12:58531955-58531977 CAATATACTCGGAGAAATATTGG - Intergenic
1097485447 12:60192539-60192561 CAAAATTCTAATAGAAATAGTGG - Intergenic
1097889831 12:64766549-64766571 GTAAAAACTGATAGAAATAAAGG + Intergenic
1098003349 12:65968930-65968952 CAAGATTTTGTTAGAAATATTGG - Intergenic
1098545424 12:71706268-71706290 CTAATTACTGATATAAATTTGGG + Intergenic
1098807646 12:75039866-75039888 CAGAATTATGAGAGAAATATAGG + Intergenic
1099105470 12:78490712-78490734 AAAAATACTGAAATAAATCTTGG - Intergenic
1099435586 12:82641221-82641243 CAAAATAATACTGGAAATATTGG + Intergenic
1099477525 12:83125198-83125220 CAAGGTAATGATAGAAATCTGGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099616767 12:84945565-84945587 CAAGAAACGGAAAGAAATATGGG - Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099860461 12:88219339-88219361 AAAAAAACTGCCAGAAATATGGG + Intergenic
1100371170 12:93970305-93970327 CAAAATTCTTAGAGAAATACTGG + Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1102581136 12:113888880-113888902 TAAAATATAGATAGAAATAAAGG + Intronic
1103711014 12:122912691-122912713 GAATATACTGAGAGAAATAAAGG - Intergenic
1103857058 12:123978849-123978871 CTAAATTCTGATATAAAAATGGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104338047 12:127919021-127919043 CACAATACTGATAGGCAGATTGG - Intergenic
1104659351 12:130599065-130599087 AAAAATGGTGATGGAAATATTGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1107225874 13:38046286-38046308 CAAAATATGGATAGGAATAAAGG + Intergenic
1107410694 13:40155936-40155958 TAAAATACTGAAAGTAATTTGGG - Intergenic
1108288905 13:48937883-48937905 CAAAATATTAGCAGAAATATTGG + Intergenic
1108909765 13:55532539-55532561 CAAAATACTGATATCACCATGGG - Intergenic
1108965532 13:56294775-56294797 TAAAAGACTGAGAGAAATCTGGG - Intergenic
1108992892 13:56685580-56685602 AAAACTAATGATAAAAATATTGG + Intergenic
1109119621 13:58438295-58438317 CCAAATTCTGTTAGAAATTTAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109419687 13:62095407-62095429 TAAAAAACTGATAAGAATATAGG + Intergenic
1110039632 13:70736448-70736470 CAAATTATTCATATAAATATGGG - Intergenic
1110585357 13:77184627-77184649 CAAAACACTGACAGAACTACAGG - Intronic
1111206040 13:85012531-85012553 CAAAATAGTGGTAGAAACAGGGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111255611 13:85663496-85663518 CTAAATCCTCATTGAAATATGGG - Intergenic
1111557641 13:89901966-89901988 CAAAATACTAATATAATTTTAGG + Intergenic
1111707694 13:91771134-91771156 CAAAAATCTGATAGAAAATTAGG + Intronic
1111738904 13:92177042-92177064 CAAAACAATGATGGAAATAAGGG - Intronic
1111747406 13:92287827-92287849 AAAAATACTTAAAGAAATACAGG - Intronic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1113059314 13:106304550-106304572 CCAAAAACAGATAGAAAAATTGG + Intergenic
1113323797 13:109264508-109264530 CAAAATAATGATGGAAATGATGG - Intergenic
1114013246 14:18397918-18397940 GAAAATAGAAATAGAAATATTGG + Intergenic
1114311793 14:21474244-21474266 CATCCTACTGATAGAAATTTGGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114702499 14:24693416-24693438 AAAAATACTGAGAGAAGCATTGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1115392847 14:32872955-32872977 CATGGTACTGATAGAAAAATAGG - Intergenic
1115767561 14:36639133-36639155 CAAAATACTGATGGAGAGAAGGG - Intergenic
1116079024 14:40149306-40149328 CAGATAACTGATAAAAATATTGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116596708 14:46857954-46857976 GAAAATATTGTTAGAAATAATGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1117311516 14:54528882-54528904 CTAAATACTGAGAGTAAAATTGG + Intronic
1118245009 14:64101773-64101795 AAAAATACAGATAAAAAAATGGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120492876 14:85198979-85199001 CAAAATAGTTATGGAAATAATGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1122085844 14:99303449-99303471 GAAAAAACTGATAGAACTAAAGG + Intergenic
1122486241 14:102083051-102083073 CAAAATCATGAAAGACATATTGG - Exonic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123912259 15:24979434-24979456 CATAATACTGATAGACTGATTGG + Intergenic
1124387100 15:29218594-29218616 CATAATACTGGTATAAAAATAGG + Intronic
1124781792 15:32642809-32642831 CAACATAATAATAGCAATATAGG + Intronic
1124826134 15:33097351-33097373 AAAAATACTTAAAGAAGTATTGG + Intronic
1125555759 15:40583337-40583359 GAAAATAATGATAAAAATAAAGG + Intergenic
1125643960 15:41255366-41255388 AAAAATACTTATTGAAAAATTGG + Intronic
1126002609 15:44225335-44225357 CAAAATAAAATTAGAAATATAGG + Intergenic
1126384640 15:48081585-48081607 CAAAACTCTAATAGAAAAATTGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126787395 15:52188599-52188621 CAAAATGCTCATCGAAACATTGG - Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127174000 15:56334543-56334565 GAAACTACTGAAAGAAATACTGG + Intronic
1127745176 15:61962015-61962037 CTTAATACTGCTAGAAAAATAGG - Intronic
1128102751 15:65017233-65017255 CAAAATGTTGATAGGAACATGGG + Intronic
1128440942 15:67707964-67707986 AAAAAAACTGATAAAAATGTAGG + Intronic
1128482321 15:68049972-68049994 CAAAATACAACTGGAAATATTGG + Intergenic
1128775776 15:70319007-70319029 AAAAATAAAGATAGAGATATAGG - Intergenic
1129429844 15:75491702-75491724 CAGAAAACTGGTAGAAATATGGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131173863 15:90197745-90197767 CAAGCTATTGATAAAAATATTGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1132446110 15:101920344-101920366 CAAAATATTAATAGGAAAATGGG - Intergenic
1134464302 16:14460324-14460346 CAATATACAGACAGAAATAAAGG + Intronic
1135894927 16:26390976-26390998 AAGAATTCTGATAGAAATGTTGG - Intergenic
1136078574 16:27836425-27836447 CCAAGTACTGAAAGAAATAATGG - Intronic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136729440 16:32394875-32394897 CATAATACTGGTATAAAAATAGG - Intergenic
1136996184 16:35190285-35190307 CATCATACTGGTAAAAATATTGG - Intergenic
1137814527 16:51385949-51385971 CTAAATTCTGCTAAAAATATAGG + Intergenic
1137996829 16:53225059-53225081 TAAAATACTGAGAGAAAGAAAGG - Intronic
1138042373 16:53686109-53686131 ATAACTACTGAGAGAAATATGGG - Intronic
1138312306 16:56038015-56038037 CAAAGCACTGAAAGAAATAATGG - Intergenic
1138998568 16:62481022-62481044 TAAAATATTGATACAAATTTTGG - Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139819144 16:69706352-69706374 CAAAATACTGATCTGAAGATGGG + Intergenic
1202996955 16_KI270728v1_random:122418-122440 CATAATACTGGTATAAAAATAGG + Intergenic
1203023642 16_KI270728v1_random:434760-434782 CATAATACTGGTATAAAAATAGG + Intergenic
1142942853 17:3397408-3397430 TAAAATATTGATATTAATATTGG - Exonic
1143132564 17:4688976-4688998 CATGATACTGATATAAAAATAGG + Intronic
1143414726 17:6737885-6737907 CATGATACTGGTATAAATATAGG + Intergenic
1143666382 17:8364171-8364193 AAAAATAATGATAAAAATATTGG - Intergenic
1143701186 17:8661378-8661400 GAAGATGATGATAGAAATATAGG - Intergenic
1143705145 17:8692431-8692453 CAAAATACTGATGAATTTATGGG + Intergenic
1143973443 17:10812732-10812754 GAAAATGGTGACAGAAATATCGG - Intergenic
1144014614 17:11182183-11182205 CAAAGTAGTGATAGAATTGTTGG + Intergenic
1144195675 17:12892503-12892525 AAAAATACTCAGAGAAATAATGG - Intronic
1146530045 17:33600810-33600832 CAGAATGTTGGTAGAAATATGGG + Intronic
1148247210 17:46041009-46041031 CAAAATACTGATAGAAATACGGG + Intronic
1148405454 17:47409903-47409925 CAAAATAACGCTAGAAAGATAGG - Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149094255 17:52821556-52821578 TTAAAAACTGATGGAAATATAGG - Intergenic
1149129095 17:53274175-53274197 CCAAATGCTCATAGAAAAATCGG + Intergenic
1149154958 17:53617497-53617519 CAAAATACTAACATAAATATAGG - Intergenic
1149282263 17:55120623-55120645 CAAAATACTTGTAGACATACTGG + Intronic
1150971788 17:70036334-70036356 TAAAATACTGATATAAACAAAGG + Intergenic
1151841595 17:76622205-76622227 CAAAAACCTAATAGAAAAATAGG - Intergenic
1153663218 18:7344391-7344413 AAAAATATTGAAAGAAATAATGG + Intergenic
1154344144 18:13528309-13528331 CAAAATAATAATAGTAATAATGG - Intronic
1154958430 18:21282967-21282989 AAAAATGCTCATAGAAAAATAGG - Intronic
1155592804 18:27447271-27447293 CATAATTCTGCTAGAAATAATGG - Intergenic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156739916 18:40312073-40312095 CTAAATACTACTATAAATATTGG - Intergenic
1156975866 18:43220957-43220979 CAGAAAGCTGATAGAAATACAGG - Intergenic
1157705831 18:49805550-49805572 GAAAACACTGATATAAAAATAGG - Intronic
1157902106 18:51528361-51528383 AAGAATACAGATAGAAATAGGGG - Intergenic
1158096345 18:53776238-53776260 CAAAATCATCATAGAAAAATCGG - Intergenic
1158782881 18:60673036-60673058 CAAAATTCTGATTGATATTTAGG + Intergenic
1159280263 18:66275797-66275819 TAAAATATTGATATAAATATTGG - Intergenic
1159392921 18:67817627-67817649 AATAATACTGCTATAAATATGGG + Intergenic
1159693692 18:71525849-71525871 GAAAATATTGAAAGAAAAATTGG + Intergenic
1159767327 18:72506203-72506225 GAAAATAATGAGAGACATATTGG - Intergenic
1159767531 18:72508539-72508561 TAAAATACTGATAGAAATGAAGG + Intergenic
1159970087 18:74639289-74639311 CAAAATTGTAATACAAATATTGG + Intronic
1160010266 18:75101965-75101987 TGAAATGTTGATAGAAATATGGG - Intergenic
1160459597 18:79028085-79028107 AAAAATACTGAAAGAAATAATGG + Intergenic
1160639198 19:113369-113391 CAAAATATTAATAGGAAAATGGG + Intergenic
1162394253 19:10407286-10407308 TAGGATACTGATAGAAATAGAGG + Intronic
1164174653 19:22760417-22760439 CAAAGTACTGAAAGAAATGGTGG + Intronic
1164654796 19:29912417-29912439 CAAAATAAAGATAGAAAGCTGGG - Intergenic
1164661381 19:29973645-29973667 AAAAATATTTATAGAAAAATAGG + Intronic
1166057065 19:40297036-40297058 CCTAAAACTGCTAGAAATATAGG + Intergenic
1166288946 19:41849444-41849466 CAATTTACTGATAGAAAAACAGG - Intronic
1166951711 19:46432827-46432849 CAAAATAATAATAATAATATAGG - Intergenic
1167735412 19:51291619-51291641 CAAAATGATGACAGAAATCTGGG + Intergenic
1168091377 19:54087344-54087366 CAAAATAATGATTGCAATACTGG + Intergenic
1168514398 19:56999068-56999090 CAAAATACTTATGTAAATATTGG - Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925306986 2:2855061-2855083 CAAAACACTGACAGTAACATGGG - Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925651834 2:6098897-6098919 CATGGTACTGATACAAATATAGG - Intergenic
925676737 2:6370118-6370140 CAAAATACATAGAAAAATATTGG - Intergenic
928941113 2:36728243-36728265 TAAAATAATGATAAAAATATAGG - Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929389840 2:41457339-41457361 AAAAAAAGTGTTAGAAATATAGG - Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930346854 2:50193720-50193742 TAAGATACTCATAGAAAAATGGG + Intronic
930471081 2:51814463-51814485 CAACATACTCAAAGAAATATAGG + Intergenic
930532470 2:52607167-52607189 ATAAATACTTACAGAAATATTGG + Intergenic
930691177 2:54366734-54366756 AAAAATACTGAAAGTAATAATGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
931468105 2:62509895-62509917 AAAAAAAGTGATAGAATTATGGG + Intronic
931616713 2:64166706-64166728 CAAAAAAGTGCTAGAAATGTAGG - Intergenic
932272392 2:70422217-70422239 CAAACTATTGGTAGGAATATTGG - Intergenic
932382195 2:71294823-71294845 CAAATTGCTGAAAGAAATAAAGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
933096063 2:78182764-78182786 CTAAAAAGTGATAGAAATTTAGG - Intergenic
933401221 2:81797980-81798002 TAAAATACTCAAAGAAATAGTGG + Intergenic
934185740 2:89672912-89672934 CATAATACTGGTATAAAAATAGG - Intergenic
934316702 2:91927717-91927739 CATAATACTGCTATAAAAATAGG + Intergenic
935107379 2:100057538-100057560 AATAACACTGATAGTAATATTGG - Intronic
935158166 2:100502648-100502670 AAAAAGACTAAAAGAAATATAGG + Intergenic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935823056 2:106913812-106913834 TAAAAAACTGAAAGAAAGATAGG - Intergenic
935828522 2:106975448-106975470 TAAAATACTCATAAAAATAATGG - Intergenic
935856591 2:107281376-107281398 TAATATACAGATAGAGATATAGG + Intergenic
935925354 2:108062900-108062922 CAAAATCCTGAACAAAATATTGG + Intergenic
936718023 2:115213115-115213137 GAAAATTCTGAGAGAATTATAGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937317319 2:120940128-120940150 CAAAATACTTATTCAAATAATGG - Intronic
937381286 2:121379655-121379677 CAAAAAACTGAAAGAATGATGGG + Intronic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938749547 2:134315410-134315432 AAAAATAGTGATAGGAATAATGG + Intronic
938768259 2:134478391-134478413 CATAATGCTCATAAAAATATGGG + Intronic
938855325 2:135304500-135304522 CAAAATAATGAGAAAACTATAGG - Intronic
938869640 2:135461755-135461777 CAAAAAAATGATTCAAATATAGG + Intronic
938916195 2:135942711-135942733 CAAAAAACTTATAGCAAGATAGG + Intronic
939447334 2:142327430-142327452 CATAATATTTATAAAAATATAGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939677511 2:145090686-145090708 CAGAATGTTGATGGAAATATGGG + Intergenic
939842866 2:147209954-147209976 AAAAGGACTGATAGAAATGTTGG - Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940549485 2:155134932-155134954 CAAAAGACTGATAGAATTCATGG + Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
940650110 2:156434001-156434023 GAAAAAAATGATAAAAATATTGG + Intergenic
940690383 2:156911027-156911049 TAAAATACTTAGAGAAATAACGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941631442 2:167889595-167889617 CTAAATACTGAAACAAATTTTGG - Intergenic
942477710 2:176345558-176345580 CAAAATAAGGATAGAGATAGGGG + Intergenic
943005088 2:182379487-182379509 CAAACGTCTGATAGAAATAAGGG + Intronic
943213065 2:184993300-184993322 CAACATTCTGATAGATATATTGG + Intergenic
943227620 2:185200116-185200138 CAAAATTATGATAGATATATAGG - Intergenic
943296644 2:186148667-186148689 CAAAACACTGATAGTAATCCAGG - Intergenic
943306040 2:186263995-186264017 TAATATACAGATAGAAATCTGGG + Intergenic
943334647 2:186599221-186599243 CAAGAAACTGATTGAAATATAGG - Intronic
943359704 2:186902432-186902454 CAAAATAATGATAGCATTTTAGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945519438 2:210805587-210805609 CAAATTCCTGAAAGAAATAAGGG + Intergenic
945603922 2:211903714-211903736 CAATATACTGATAAAAAAAGAGG + Intronic
945711098 2:213295816-213295838 CAAAAGACAGATAGCAATGTAGG + Intronic
946468973 2:219938951-219938973 CAGAATGCTCATAGAAACATGGG + Intergenic
946551340 2:220804926-220804948 CAAAACACTGTGAGAAATAGAGG - Intergenic
946887137 2:224232906-224232928 AAACATACTGAAAGAAATCTGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
947955350 2:234185149-234185171 CAAAAGACTCACAGAAATAAAGG - Intergenic
948090459 2:235289601-235289623 CAAAAGCCTGATAGATAAATGGG + Intergenic
1169077953 20:2773517-2773539 AAAAATACTGGAAGAAATAGTGG + Intergenic
1169741246 20:8897159-8897181 AAAAATACACATAGAAATTTGGG - Intronic
1169983658 20:11416901-11416923 ACAAAAACTGATAGAAATAAAGG - Intergenic
1170696641 20:18665147-18665169 CACACTACTGATAAAAAGATTGG - Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1170865113 20:20148114-20148136 CATAATACTGGTATAAAAATAGG - Intronic
1170927137 20:20735244-20735266 CAAATTTCTAATAGAAAAATGGG + Intergenic
1171187713 20:23135003-23135025 AAAAATACTAATAGATAAATTGG + Intergenic
1171197245 20:23209412-23209434 CAGAATGTTGATATAAATATGGG + Intergenic
1174778662 20:53368653-53368675 CCATAAACTGATAGCAATATAGG + Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177073522 21:16542853-16542875 CAAAATATCAAAAGAAATATTGG - Intergenic
1177340492 21:19793421-19793443 CAAAATAATGATAAATATATTGG - Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177478071 21:21650425-21650447 CAATATGCTAATAGAAATATGGG + Intergenic
1177514290 21:22128040-22128062 CAACATACTGAAAAAAATTTAGG + Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177762171 21:25414473-25414495 CTAAAATGTGATAGAAATATTGG - Intergenic
1177946790 21:27480396-27480418 CTAAATTTTGATAGAAATATGGG - Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178561964 21:33646405-33646427 CAACATACTGCTATAAAAATTGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179443680 21:41415752-41415774 CATGATACTGATATAAAAATAGG + Intergenic
1180120427 21:45742868-45742890 CAAAATATTTTTTGAAATATTGG - Intronic
1180543035 22:16470185-16470207 CATAATACTGGTATAAAAATAGG + Intergenic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181119981 22:20659250-20659272 CAAAATAAAGATTTAAATATAGG - Intergenic
1181337364 22:22148081-22148103 CAAAAGACTTAGACAAATATGGG + Intergenic
1183895385 22:40964345-40964367 CAAAATACTGCTAACAAAATTGG - Intronic
949382777 3:3464570-3464592 CAATTCACTGCTAGAAATATAGG + Intergenic
949612535 3:5717210-5717232 CTCAATACAGATGGAAATATGGG - Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951503366 3:23415345-23415367 AAAAATACTGATACAGACATAGG - Intronic
951683766 3:25322324-25322346 CAAAGTTCTAAAAGAAATATGGG + Intronic
951977147 3:28524705-28524727 CAAATTAATTATAAAAATATTGG + Exonic
952465919 3:33585819-33585841 AAAAATAGTGATAGAATTACCGG - Intronic
953100150 3:39816738-39816760 CATAATAATTATAGAAATATAGG + Intronic
953382596 3:42485055-42485077 TAAAATACTGGTATAAATATAGG + Intergenic
953997105 3:47528318-47528340 CAAAATACTCAGAGAAATAATGG + Intergenic
954733346 3:52684427-52684449 CTAAATATTACTAGAAATATAGG - Intronic
955336391 3:58089641-58089663 CAAAATAATAATAAAAATTTAGG + Intronic
955636816 3:61039396-61039418 CAAAATACAATCAGAAATATTGG - Intronic
955869370 3:63420831-63420853 AAAAATACAAATAGAAAAATGGG + Intronic
956303568 3:67799115-67799137 AAAAATACTAAAAGAAATCTAGG - Intergenic
956321629 3:68004003-68004025 CAAAATACTGATAGTATTAGTGG - Intergenic
956446775 3:69333438-69333460 CAAAATATTCATGGAAATCTGGG - Intronic
956987560 3:74719848-74719870 CAAAAAACTGATAGAACTGAAGG - Intergenic
957015844 3:75064180-75064202 CATAGTACTGGTAGAAAAATAGG - Intergenic
957167279 3:76691211-76691233 CAAAACAGAGATAGAAAAATTGG - Intronic
957511648 3:81196166-81196188 CTAAAAACAGATACAAATATAGG + Intergenic
957892243 3:86375589-86375611 GAAAATACTGATGGAAATGAGGG + Intergenic
957903964 3:86534174-86534196 CAAAATACTGGTAGAAATATGGG - Intergenic
957990643 3:87622817-87622839 CAAATTAGGGATAGCAATATAGG + Intergenic
957996646 3:87698530-87698552 CAAAATACTGAAATAAAGTTAGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958802608 3:98774104-98774126 CAAATTACTACTAGAAATTTTGG - Intronic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959260350 3:104071607-104071629 CAAAATGCTGATAAAAATCCAGG + Intergenic
959328384 3:104968822-104968844 CATAATACCCAAAGAAATATAGG - Intergenic
959463624 3:106657584-106657606 CACAGTACTGGTATAAATATAGG + Intergenic
959999027 3:112711517-112711539 CATAAGAATAATAGAAATATTGG + Intergenic
960253914 3:115489701-115489723 TAAAATATTGATATAAATACAGG - Intergenic
960435433 3:117620982-117621004 CAAGATTCTCAAAGAAATATGGG + Intergenic
960774852 3:121237942-121237964 CAAAATACTGACAGAAATATGGG - Intronic
961990536 3:131185292-131185314 AAGAAAACTGATAGAAAGATTGG + Intronic
962400475 3:135055014-135055036 CAAAATATTAATAGAATTATGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963512221 3:146261185-146261207 CAAACTACTTTTATAAATATGGG + Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964498366 3:157319964-157319986 AAAAATAAGGATAAAAATATTGG - Intronic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964828999 3:160862188-160862210 CAAAATACTAAAAGTAATTTTGG - Intronic
965115374 3:164481535-164481557 CAGAATATTCATAGATATATAGG + Intergenic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965717636 3:171624195-171624217 CAAAATCTTAATAGAAAAATGGG + Intronic
965788435 3:172361571-172361593 CAAAGCGCTGATGGAAATATGGG - Intronic
966695643 3:182787910-182787932 TGAATTACTGACAGAAATATTGG - Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
966761702 3:183425218-183425240 CAAGACACTTATGGAAATATGGG + Intronic
967678607 3:192331857-192331879 CCAAATGCTGAGAAAAATATTGG + Intronic
969099698 4:4759699-4759721 CAAAAGACAGACAGAAACATTGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970656053 4:18230880-18230902 CAAAATAATGATACTAAAATAGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971521098 4:27551338-27551360 CAAAATACAGACACAAATATAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971722330 4:30261677-30261699 TAAAATGCTGATAGAAATTCTGG - Intergenic
971852333 4:31998085-31998107 CATAAATCTGAAAGAAATATTGG + Intergenic
971860481 4:32096819-32096841 CAGAATGTTGATAGAAATATGGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
972959433 4:44434159-44434181 CAAATTATTGACAGAAATGTGGG - Intronic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973683953 4:53350423-53350445 CAAAATAGTTCTAGGAATATAGG - Intronic
974092595 4:57327758-57327780 TAAAATAATGTTAGAACTATTGG - Intergenic
974210944 4:58775742-58775764 GAAAATATTGAAAGAAATAATGG + Intergenic
974376383 4:61082139-61082161 CAAAAAATTGATGGAAATATAGG - Intergenic
974437780 4:61878481-61878503 CAAAATACTTATAGACTTACAGG - Intronic
974477250 4:62399056-62399078 AAAAAACCTGATAGAAATATGGG - Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
975099764 4:70499457-70499479 CATAATACTGATATTAAAATTGG + Intergenic
975506613 4:75145129-75145151 TAAAATGCTGACAGAAATATGGG - Intergenic
976412285 4:84728800-84728822 CAAAATAATGCTAAAATTATTGG - Intronic
976783992 4:88796922-88796944 AATAATAATGAGAGAAATATGGG - Intronic
976787870 4:88842931-88842953 CAAAATACTGAGAGAAATATCGG + Intronic
976984254 4:91272957-91272979 CATGATACTGATATAAAAATAGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977379534 4:96254330-96254352 TAAAATACTGAAAGAAAAATTGG + Intergenic
977446161 4:97135687-97135709 TAAAAAACTGATGGAGATATTGG - Intergenic
977509626 4:97946061-97946083 AAAAATAATAATAGAAATAAAGG + Intronic
978102427 4:104858879-104858901 CCAGACACTGATAGAACTATTGG - Intergenic
978750962 4:112246867-112246889 CAAAATAGAGAAAGAAATGTTGG - Intronic
978955570 4:114608446-114608468 CAAAATACGTATAGAAAATTAGG - Intronic
979855617 4:125629706-125629728 CAAAATACACATATAAGTATAGG + Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980343293 4:131579904-131579926 CAAAATAGTGTTAAAAATAATGG - Intergenic
980388491 4:132117248-132117270 CAAAATATTAATAATAATATGGG + Intergenic
980431253 4:132699495-132699517 CAAAAGACAGATAGATATATTGG + Intergenic
980518542 4:133898509-133898531 CAAAAAACTCATTCAAATATGGG - Intergenic
980534350 4:134096456-134096478 CAAAATATTCATAAAAATATTGG + Intergenic
980580434 4:134743492-134743514 CATGATACTGATATAAAAATAGG + Intergenic
980802816 4:137774632-137774654 CAATTTACTGATATATATATAGG + Intergenic
980818365 4:137978941-137978963 AAAAATATTGATAGATATACTGG - Intergenic
981215572 4:142162319-142162341 AAAAAAACTGATGGAAAAATTGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981559018 4:146026751-146026773 CAAAATATTGAAAGGAATTTAGG + Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983093295 4:163532270-163532292 AAATAGACTGATACAAATATAGG + Intronic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983386750 4:167073017-167073039 CAAAATAAATATGGAAATATTGG - Intronic
983423055 4:167545498-167545520 AAAAATAGTGATGGAAAAATTGG - Intergenic
983438169 4:167744045-167744067 CAAAATAAGAATAGAAATAGGGG - Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983993367 4:174150412-174150434 CCAAATACTGATACAATGATGGG + Intergenic
984033757 4:174639052-174639074 CAAAAGACAGCTAGTAATATTGG - Exonic
984387162 4:179075844-179075866 TAAAATACTAATAAAGATATTGG - Intergenic
984452887 4:179926109-179926131 CAAAATAAAGAGATAAATATAGG - Intergenic
984503237 4:180583284-180583306 CAAAATAATGGGAGAAAAATAGG + Intergenic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
984692033 4:182737350-182737372 CAAAATAAGGAAAGAAACATGGG - Intronic
984849129 4:184138473-184138495 CAAAATATTGATGTAAATGTTGG - Intronic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988447840 5:31307997-31308019 AGAAATACTTATAGATATATTGG + Intronic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988643045 5:33062766-33062788 CAAATTATTGATAAAAATAGGGG + Intergenic
988921925 5:35950761-35950783 CATAATACAAATATAAATATAGG - Intergenic
989408162 5:41085633-41085655 GACAATGCTGAAAGAAATATTGG - Intergenic
989428440 5:41323822-41323844 CAGAATACTTCTAGAAATCTAGG - Intronic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
989998145 5:50860188-50860210 AAAAATACTCAAAGAAATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991144996 5:63290940-63290962 CAAAAATCTGATAGAAAAATGGG - Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991221212 5:64221180-64221202 TAAAATAGTGATCCAAATATTGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993547189 5:89227996-89228018 CAAAGTACTGAAAGAAAAAAGGG - Intergenic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993802995 5:92367871-92367893 TCTAATACTGACAGAAATATTGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994692062 5:103032056-103032078 CAAAGTACTGATATAAAAAAAGG + Intergenic
994770637 5:103976792-103976814 GAAAATAAACATAGAAATATGGG + Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995843736 5:116470294-116470316 CAAAATAATGCTACAAAAATAGG + Intronic
995916478 5:117251596-117251618 CATAATACAAATAGAAATATAGG + Intergenic
996041984 5:118824641-118824663 TAAAATTCTGATAGAAATTCTGG - Intergenic
996401271 5:123065741-123065763 CAAAGTAATGATAAAAATACAGG - Intergenic
996450471 5:123617164-123617186 TGAGATACTGTTAGAAATATGGG - Intergenic
996870735 5:128190363-128190385 CAAATTATAGTTAGAAATATAGG + Intergenic
997810804 5:136966439-136966461 CATAATATTGCTAGGAATATTGG + Intergenic
997810805 5:136966466-136966488 CAAAATATTGCTATGAATATTGG + Intergenic
999337936 5:150739707-150739729 CATAATACTGGTATAAAAATAGG + Intronic
999841586 5:155433291-155433313 CAAAATAGGGATAGCAATAATGG - Intergenic
1000404472 5:160872737-160872759 CATAATACTGGTATAAAAATAGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1002746549 6:61774-61796 CAAAATATTAATAGGAAAATGGG + Intergenic
1002893508 6:1359193-1359215 CAAAAACCTAATAGAAAAATAGG - Intergenic
1004032653 6:11886084-11886106 AAAAATACTCAAAGAAATAATGG + Intergenic
1004048240 6:12047190-12047212 CAAATTACTGCTAAAAGTATTGG - Intronic
1004989747 6:21124178-21124200 CAAAATACTTATCTAAACATAGG + Intronic
1005102031 6:22181783-22181805 AAAAATATTGATACAAAAATTGG - Intergenic
1005770715 6:29067948-29067970 CAAAATTCTTAAAGAAAAATTGG + Intronic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1006946339 6:37786968-37786990 AAAAATAATGATAAAAATAAAGG + Intergenic
1006948846 6:37804824-37804846 CAAAATTCTAAGAGGAATATTGG + Intergenic
1007230446 6:40344295-40344317 CAGAATGCTGATTGACATATAGG - Intergenic
1008231877 6:48992893-48992915 CACAATACTGTTATAAAAATAGG + Intergenic
1008445829 6:51589355-51589377 ATAAAATCTGATAGAAATATTGG - Intergenic
1009608812 6:65909612-65909634 AAAAATACTGATAACAATAAGGG - Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1009930829 6:70175142-70175164 AAAATAACTGATAGAAAAATGGG - Intronic
1010103586 6:72141069-72141091 CAAAATATTGTTGGAAATATTGG - Intronic
1010163813 6:72891834-72891856 CAAAAATCTGATAGTAATCTAGG + Intronic
1010226484 6:73494251-73494273 GAAAATACTGAGAATAATATTGG + Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010822730 6:80433911-80433933 CAAAATATTTAAAGAAATAATGG - Intergenic
1011796383 6:90958135-90958157 CTAAATGCTAGTAGAAATATGGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012056280 6:94415183-94415205 CAAATTACTGATCCATATATGGG - Intergenic
1012056505 6:94418906-94418928 CAAAATAATGATAAATATATGGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012750270 6:103152605-103152627 AAAAATACAAATACAAATATTGG + Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1012801153 6:103830486-103830508 CAAAATACTGTCAAGAATATGGG - Intergenic
1012902676 6:105024857-105024879 GAACATACTTAGAGAAATATTGG - Intronic
1013357046 6:109354993-109355015 TCAAATACTCATAGAAATAAAGG - Intergenic
1013516076 6:110887261-110887283 CAAATTACTTAAAGAAAAATAGG - Intronic
1013651778 6:112202311-112202333 CAAAAAAGTAATAAAAATATTGG + Intronic
1013815651 6:114094459-114094481 CAAATTCCTGTTAGAAATGTAGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1013914022 6:115312565-115312587 CAAAGTACTGGGAGAGATATGGG - Intergenic
1014210993 6:118707930-118707952 CCTATTACTGGTAGAAATATGGG + Intronic
1014791358 6:125676042-125676064 CAAAAAACTGGTAGTAAAATGGG - Intergenic
1014822987 6:126014226-126014248 TAAAATACAAATACAAATATAGG - Intronic
1015026509 6:128539391-128539413 AAAAAAAAAGATAGAAATATTGG - Intergenic
1015104852 6:129523754-129523776 CAAACTACAGATATAAACATGGG + Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1016016060 6:139187441-139187463 CAAAATACTGAATTAAACATGGG - Intergenic
1016031152 6:139339702-139339724 CAAAAAACTGATAGATCTACAGG - Intergenic
1016273836 6:142324573-142324595 TAAAATAAGGATAGAAAGATAGG + Intronic
1016376535 6:143426738-143426760 GAAATTACTGATTGAAATTTGGG - Intronic
1016554485 6:145320563-145320585 AAAAGTACTTAAAGAAATATGGG - Intergenic
1016634247 6:146269416-146269438 TAAAACACTGATAGAAAGAATGG + Intronic
1016842962 6:148543078-148543100 CAAAATACTGATAAAGTTTTAGG - Intronic
1017466436 6:154697886-154697908 AAAAACAGTCATAGAAATATAGG + Intergenic
1017553217 6:155533773-155533795 AACAAGACTGAAAGAAATATCGG + Intergenic
1017966011 6:159266657-159266679 CAAAATTCTATTAGAAATCTAGG + Intronic
1019072276 6:169357353-169357375 CAAAATAATGATTGAATTAAAGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020038881 7:4986195-4986217 AAAAAGACTGAAAGAAAAATAGG + Intronic
1020862210 7:13508096-13508118 CAAAATAATGTCAGAAATACTGG + Intergenic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021030906 7:15734782-15734804 CAAACTACTGTTATAAATAAAGG - Intergenic
1021933038 7:25600902-25600924 CATGTTACTGATAGAAATACTGG + Intergenic
1022021758 7:26406345-26406367 CAAAATCCTGACAGTAATTTGGG - Intergenic
1022878633 7:34563158-34563180 AGAAAAACTGATAGAAACATTGG - Intergenic
1023573503 7:41598406-41598428 GCAAAAACTGACAGAAATATAGG + Intergenic
1025142203 7:56475580-56475602 CCAAACATTGAAAGAAATATTGG - Intergenic
1026138668 7:67686018-67686040 CAAAATATTGATACATAAATAGG - Intergenic
1026490410 7:70858241-70858263 CAATATGCTGAAAGCAATATGGG - Intergenic
1027172226 7:75880640-75880662 CAAAGAACTGATGGTAATATTGG - Intronic
1027360286 7:77401169-77401191 AAAAATACTTCAAGAAATATTGG + Intronic
1027723696 7:81775896-81775918 CAAAATACTAGTAGAAAGAAAGG - Intergenic
1027789376 7:82620015-82620037 CAGAATGCTGATAGAAATACTGG + Intergenic
1027911408 7:84256425-84256447 TAAAATAATGATTGAAATAATGG - Intronic
1028189730 7:87832220-87832242 CAGAATACACATGGAAATATTGG - Exonic
1028302047 7:89212161-89212183 CAAATTCCTGATGGAAATTTGGG - Intronic
1028676226 7:93465055-93465077 CTGAAAGCTGATAGAAATATAGG - Intronic
1030236558 7:107269691-107269713 CAAAACATTGATAAACATATAGG - Intronic
1030390058 7:108916704-108916726 CATAATACTGGTATAAAAATGGG - Intergenic
1030689048 7:112514124-112514146 CAAAACTCTGATAGAGATAAAGG + Intergenic
1030781004 7:113600103-113600125 CAACGTTCTGATAGAAAAATAGG + Intergenic
1030831701 7:114232020-114232042 CAAATAACTGATTGAAAAATGGG + Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031457022 7:121993794-121993816 TAAACTACATATAGAAATATAGG + Intronic
1031611579 7:123833947-123833969 CATAATACTGATATAAAAATAGG - Intronic
1032281626 7:130507656-130507678 CAATATACTGATAGCAAAATGGG + Intronic
1032740966 7:134738804-134738826 CAAGGTACTGATACAAATGTTGG + Intergenic
1032863903 7:135906774-135906796 AAAAATCCTGATGGTAATATGGG + Intergenic
1033346489 7:140529128-140529150 AAAAACACTGGGAGAAATATTGG + Intronic
1033379604 7:140802002-140802024 AAAACTACTAATAAAAATATTGG + Intronic
1033975369 7:147094243-147094265 CAGAATGTTGATAGAAATTTGGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035005926 7:155660803-155660825 AAAAATACTCAAAGAAATAATGG - Intronic
1035011085 7:155715395-155715417 TAAAATAGTCTTAGAAATATAGG + Intronic
1035014584 7:155753876-155753898 CAAAAGAGTGAAAGAAAAATAGG + Intronic
1036009402 8:4704669-4704691 CAAAATACTTTTGGAAAAATTGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037139451 8:15502799-15502821 GAAAAGATTGATAAAAATATGGG - Intronic
1037791570 8:21947908-21947930 GTAAAAACTGATAGAACTATAGG + Intronic
1038606004 8:29005345-29005367 CAATATAGAGATAGAAATGTAGG + Intronic
1038812004 8:30856885-30856907 CAAAATTCTGATAGATTTGTTGG + Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039685204 8:39794323-39794345 CCTAAAACTGCTAGAAATATGGG + Intronic
1040662040 8:49584823-49584845 CAAAATACTAAAAGTAACATGGG + Intergenic
1040692161 8:49952316-49952338 CAAAATCCTGATGAGAATATGGG + Intronic
1041506996 8:58610061-58610083 AAAAATAATGACAGAAAAATAGG - Intronic
1041681204 8:60594202-60594224 AAAAATACTCAAAGAAATAATGG + Intronic
1041963755 8:63650239-63650261 CAAAATTCTCTCAGAAATATAGG + Intergenic
1041971752 8:63751047-63751069 CTAAATATTGATATAAGTATGGG + Intergenic
1042192688 8:66203556-66203578 TATAATACTGATAAACATATAGG - Intergenic
1042196970 8:66238955-66238977 CAGAAGATTGGTAGAAATATAGG - Intergenic
1042201561 8:66283705-66283727 CCAAATACAGAAAGAAAAATAGG + Intergenic
1042427497 8:68665224-68665246 CAAAATACAGATGGAAATATTGG + Intronic
1042731666 8:71942231-71942253 CAAAGTAATGCTAGAAACATTGG - Intronic
1043308632 8:78829691-78829713 CAAAAACCTGATATAAAAATGGG + Intergenic
1043370255 8:79583243-79583265 CAAGACACTGATAGTTATATGGG + Intergenic
1043386934 8:79757964-79757986 AAAAATCCTGTCAGAAATATTGG + Intergenic
1043616745 8:82134675-82134697 CATAATACTGGTATAAAAATAGG + Intergenic
1043648193 8:82550043-82550065 CAAAATAATGTTAAAAAAATAGG - Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044078068 8:87847614-87847636 CAGAATATTGGTAGAAATGTGGG - Intergenic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044164626 8:88966871-88966893 CAGAATGTTGGTAGAAATATTGG + Intergenic
1044451248 8:92337908-92337930 CATAGTACTGATATAAAAATAGG + Intergenic
1044505386 8:93011432-93011454 CAAGATACAGATGGAAAAATTGG + Intronic
1044759388 8:95501821-95501843 CAAAGAACTGATAATAATATAGG - Intergenic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045058924 8:98394583-98394605 CCAAATAGTGAAAAAAATATTGG + Intergenic
1045624276 8:104024266-104024288 CAGAACACTGATAGATATCTTGG - Intronic
1045724390 8:105155202-105155224 CAAAATACTGAGAAAAATACTGG - Intronic
1045758848 8:105579255-105579277 CAAATTACGAACAGAAATATAGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1045998400 8:108390550-108390572 CAAAGTACTGATGGAAATATGGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046270982 8:111898119-111898141 CAAAATACTAATAAGAAAATAGG + Intergenic
1046454176 8:114437452-114437474 AAAAATACTCAAAGAAATAATGG - Intergenic
1046496072 8:115015154-115015176 CAAAATAATGATAGAAGAAATGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047397998 8:124520447-124520469 AAAAAGACTAATAAAAATATTGG + Intronic
1047416158 8:124666433-124666455 AAAAATACTGATGGAAACACAGG + Intronic
1048535077 8:135285716-135285738 CAACATACAAATAGAAATGTTGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050447529 9:5740906-5740928 AAAAATACTGGTATAAATGTGGG - Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050756377 9:9009158-9009180 CAAAATATTGAGATAGATATTGG - Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051183156 9:14432299-14432321 CAACATTCAGAAAGAAATATGGG + Intergenic
1051229562 9:14941589-14941611 CAAAAACCTAATAGAAAAATTGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051946469 9:22575193-22575215 CAAAATTCTGAATAAAATATGGG + Intergenic
1052475026 9:28948692-28948714 CAAAATAATGAAATAAATCTTGG + Intergenic
1052529406 9:29661349-29661371 TGAAAAACTGATAGAAGTATTGG - Intergenic
1052531036 9:29684143-29684165 CAAAATAGGGATAGTCATATGGG + Intergenic
1052534310 9:29727853-29727875 CAAAAGAATCATAGAAATATGGG + Intergenic
1055131708 9:72783080-72783102 CATGATACTGATAGAAAAACAGG + Intronic
1055287678 9:74746664-74746686 GATAATTCTGATAGAAACATAGG + Intronic
1055535246 9:77235606-77235628 AAAAATACTGGGAGAAATAATGG - Intronic
1055725183 9:79219879-79219901 CAAAATAAGGATTTAAATATTGG - Intergenic
1055840303 9:80495235-80495257 CAGAATGTTGGTAGAAATATGGG - Intergenic
1055859949 9:80737583-80737605 CAATAAACTGAGACAAATATAGG - Intergenic
1056024031 9:82473739-82473761 CAAAAAACTGATTCAAAAATGGG + Intergenic
1056420262 9:86418640-86418662 CAAAACACAGAAAGAAAGATTGG + Intergenic
1056652475 9:88479099-88479121 CAAAAAAATGAAAGTAATATAGG + Intergenic
1057118939 9:92553273-92553295 CATAATACTGGTATAAAAATAGG - Intronic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058127651 9:101213854-101213876 TTAAATACTGAAAGAAATAAAGG + Intronic
1058271459 9:102976696-102976718 CATAATGCTGGTAGAAATACAGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059007246 9:110417079-110417101 CAAAATACTTATGGAAAAATTGG + Intronic
1059201215 9:112418765-112418787 GAAAATAGTAATAGAAAAATTGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1062528104 9:136986384-136986406 CAAAATAATAATAAAAATACTGG + Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186205563 X:7196741-7196763 CAAAATACAGATAGAGAGACAGG - Intergenic
1186602566 X:11053913-11053935 CATAATACATATATAAATATAGG - Intergenic
1186667321 X:11731089-11731111 AATAATACTGAAATAAATATGGG - Intergenic
1187428185 X:19197488-19197510 CAAAATACTTTGAGAAATACCGG + Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1188787704 X:34368844-34368866 CATAGTACTGATATAAAAATAGG + Intergenic
1188977146 X:36689389-36689411 CACAACAATGATAGAAATAAAGG - Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189454202 X:41169763-41169785 CAAGATACTGAAAGTAATACAGG + Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1190091585 X:47442309-47442331 CAAAAAACTGACAGAAACAAAGG - Intergenic
1190118334 X:47640088-47640110 AAAAATACTGGTATAAATATTGG + Intronic
1190523965 X:51310115-51310137 CAAAATACGAATAGAAATGAAGG - Intergenic
1190574058 X:51815187-51815209 TAAAATACTGATAAAAATTATGG - Intronic
1190700158 X:52981785-52981807 CAACATACTCACAGAAATTTAGG + Intronic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191645288 X:63473391-63473413 AAAATTACTGAAAGAAATAATGG + Intergenic
1191724571 X:64266232-64266254 CAAAATACAGATTGAGATATGGG + Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1191970226 X:66805770-66805792 CAAAATACAGGTAAAAATTTTGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192823905 X:74674328-74674350 CAAAATAACAATAGAAAAATGGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193589435 X:83369530-83369552 CTAAATAATCAAAGAAATATTGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194172502 X:90604713-90604735 AAAAATACTAATTTAAATATTGG - Intergenic
1194224572 X:91240196-91240218 CATGATACTGATATAAAAATAGG - Intergenic
1194269751 X:91797519-91797541 CATAATACTGAGATAAATACTGG + Intronic
1194291486 X:92077838-92077860 AAAAATACTAATGGAAATAAAGG - Intronic
1194464570 X:94217627-94217649 TAAAATCCTGATAAAAATTTGGG + Intergenic
1194487872 X:94508227-94508249 AGAAATAGTGATAGAAATAATGG + Intergenic
1194780288 X:98016222-98016244 AGAAAAACTGATAGAACTATAGG - Intergenic
1195872714 X:109502627-109502649 CTGAATATTGATAGAAATATGGG - Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1196309384 X:114144493-114144515 CAAGATACTGAAAGAAAAATTGG - Intergenic
1196545059 X:116953111-116953133 GAAAGTACTTATAGAAATACTGG + Intergenic
1197102161 X:122669126-122669148 AAAAATACTATTAGAGATATAGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1197471810 X:126872675-126872697 CATAGTACTGATATAAAAATAGG - Intergenic
1197494893 X:127166674-127166696 CAACATCCTGACAGAAAAATTGG + Intergenic
1197973884 X:132144501-132144523 AAAAATACTGATAAAAATTATGG + Intergenic
1198232411 X:134704191-134704213 AAACATAGTAATAGAAATATAGG + Intronic
1198262813 X:134981121-134981143 AACAATACTGATATAAAAATAGG - Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199312697 X:146340126-146340148 CCAAATACTGTTAGAATTTTTGG + Intergenic
1199472433 X:148209835-148209857 CAAAATACTGATAGTTATTATGG + Intergenic
1199775620 X:151008884-151008906 AAAAATATTGATAGCAATAGTGG + Intergenic
1200405796 Y:2810282-2810304 AAAAAGACTCAAAGAAATATGGG - Intergenic
1200518730 Y:4182452-4182474 AAAAATACTAATTTAAATATTGG - Intergenic
1200586969 Y:5018500-5018522 CATAATACTGAGATAAATACTGG + Intronic
1200609005 Y:5302421-5302443 AAAAATACTAATGGAAATAAAGG - Intronic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201183926 Y:11379110-11379132 CATAATACTGGTATAAAAATAGG + Intergenic
1201679872 Y:16633705-16633727 CATAATATTAATGGAAATATTGG + Intergenic
1201769389 Y:17604205-17604227 CATGATACTGATACAAATACAGG + Intergenic
1201832165 Y:18301780-18301802 CATGATACTGATACAAATACAGG - Intergenic
1202190458 Y:22238085-22238107 CAAAAGACTTATAGTAAAATGGG - Intergenic