ID: 1072298082

View in Genome Browser
Species Human (GRCh38)
Location 10:94031584-94031606
Sequence AATACTGCCCTTCTGCTGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072298082 Original CRISPR AATACTGCCCTTCTGCTGTC AGG (reversed) Exonic
900254566 1:1691343-1691365 CATCCTTCCCTTCTGCTGTCTGG + Exonic
900263318 1:1744618-1744640 CATCCTTCCCTTCTGCTGTCTGG + Intronic
904724766 1:32539174-32539196 AATCCAGCCCTTCTGCCCTCCGG + Intronic
905254751 1:36673156-36673178 AATTCCTCCCTACTGCTGTCTGG - Intergenic
905417495 1:37814210-37814232 AATGCAGCCCTTCTGCTCTGAGG + Exonic
905678117 1:39844320-39844342 TATACAGCCCATCTGCTCTCTGG - Intronic
909700808 1:78520549-78520571 AAGACTGTCCTTCTGCTCTTAGG - Intronic
913968686 1:143397472-143397494 AACGCTGCCCTTATGCTGTCGGG + Intergenic
914063065 1:144223071-144223093 AACGCTGCCCTTATGCTGTCGGG + Intergenic
914116085 1:144743283-144743305 AACGCTGCCCTTATGCTGTCGGG - Intergenic
914981216 1:152415990-152416012 CATCCTGCCCTCCTGCAGTCTGG - Intergenic
918522576 1:185431000-185431022 TATACTCCCCTTCTGCAGTGAGG + Intergenic
1065466658 10:26031593-26031615 AAAAATACCCTTCTGCTGTGGGG - Intronic
1066634725 10:37489341-37489363 AATACTGCCCTCCTGCCTGCAGG - Intergenic
1069767022 10:70869935-70869957 AGGAGGGCCCTTCTGCTGTCAGG - Intronic
1070094493 10:73323623-73323645 AATACTGCGCTTTTGCCGACGGG + Intronic
1072298082 10:94031584-94031606 AATACTGCCCTTCTGCTGTCAGG - Exonic
1072781366 10:98253904-98253926 AAAACTGCCCTTCTTTTGTGGGG - Intronic
1075236485 10:120735503-120735525 ACTGCTGACCTTCTGCTGTGTGG - Intergenic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1077559428 11:3249312-3249334 AATACTTGCCTCCTGCTGTGTGG + Intergenic
1077565321 11:3295115-3295137 AATACTCGCCTCCTGCTGTGTGG + Intergenic
1078604777 11:12765523-12765545 AATACTGCACTTCCTCTGTCAGG + Intronic
1080340519 11:31258412-31258434 AATACTTTCCTTTTGCTTTCTGG - Intronic
1081613355 11:44576633-44576655 AATCCTGCTCTGCTGCTGCCTGG + Intronic
1081699353 11:45143167-45143189 AATTTTGCCCTTGTGCTTTCAGG + Intronic
1083699488 11:64466255-64466277 ATTTCTGCCTTTCTGCTGCCTGG + Intergenic
1084585585 11:70059895-70059917 AATACTGGCCTTCTGGAGTGGGG + Intergenic
1089332623 11:117700514-117700536 AATACTGGCCTTTGGCTGGCTGG - Intronic
1091707460 12:2706267-2706289 AATACTGGCCTGCTGCCTTCTGG - Intergenic
1091917523 12:4280576-4280598 CTTCCTTCCCTTCTGCTGTCTGG + Intronic
1094311076 12:29083986-29084008 GATACTGTCCTACTGCTGTTAGG + Intergenic
1095281727 12:40359608-40359630 AAAAATACCCTTCTGCTTTCTGG - Intronic
1095976997 12:47946716-47946738 CATGCTGCCCTTGTGCAGTCTGG - Intergenic
1101514768 12:105424619-105424641 AATCCTTCCCTTCTGCTCTTGGG + Intergenic
1104010259 12:124925275-124925297 CATCCTGCTCTTCTGCTGCCAGG - Intergenic
1106451734 13:29888533-29888555 AATAATGCCCTGATGCTCTCTGG + Intergenic
1112293345 13:98164314-98164336 AATGCTGCCCTGTGGCTGTCAGG - Intronic
1113562283 13:111291368-111291390 AATGCAGACCCTCTGCTGTCAGG - Intronic
1115373069 14:32641075-32641097 ATTACTGCTCTTCTACTCTCTGG + Intronic
1116964975 14:51004803-51004825 CATACTGCCCCTCTCCAGTCCGG + Intronic
1117438877 14:55742292-55742314 ATTAATGCCCTTCTCCTTTCAGG + Intergenic
1118513487 14:66502466-66502488 AATACTGCCCTTCTCTTTTATGG + Intergenic
1119206117 14:72794808-72794830 AATACAGCCCTGCTGATGCCTGG - Intronic
1120975899 14:90248055-90248077 CATGCTTCCCTTCTGCTGCCAGG - Intergenic
1121558763 14:94858563-94858585 AATAGTGACCTCCTGCTGTGAGG - Intergenic
1121970386 14:98350511-98350533 AAGACTGCCTTTCTGATGGCAGG - Intergenic
1122067584 14:99184419-99184441 AATGTTGGCCTTTTGCTGTCAGG + Intronic
1126991154 15:54377174-54377196 AATACAGCCATTATGCTGTGAGG - Intronic
1127200848 15:56648288-56648310 AATACTGCCCTAATGATGTTTGG - Intronic
1127273113 15:57418749-57418771 AACACTGCTCTTCTTCTGCCAGG - Intronic
1128359802 15:66954030-66954052 GCCACTGCCCTTCTGCTGTGGGG - Intergenic
1128477104 15:68006616-68006638 ATGACTGCCCTTCTGCGTTCTGG + Intergenic
1129125319 15:73435502-73435524 AAGACTGCCACTCTGCTGCCCGG - Intergenic
1132802214 16:1760018-1760040 AAGAGTGCCCTTCTCCTGTGTGG + Intronic
1138093965 16:54197728-54197750 AATAATTCCCCTCTTCTGTCTGG - Intergenic
1140785148 16:78334041-78334063 AATAATGCCGTTTTACTGTCTGG - Intronic
1143649236 17:8253133-8253155 AATCCTGCACTTCAGGTGTCAGG - Intronic
1144382636 17:14717959-14717981 AATAATGTTCATCTGCTGTCAGG - Intergenic
1144732592 17:17537255-17537277 AATCCTGCCCTGCTCCTGTGAGG + Intronic
1146705182 17:34996042-34996064 AAAGCTCCCCTTCTGCTTTCAGG + Exonic
1147041074 17:37719542-37719564 CAGAGTGCCCTTCTGCAGTCTGG + Intronic
1148148867 17:45384362-45384384 ACTGCTGCCCTTCTGCTGCCAGG - Intergenic
1149496721 17:57122986-57123008 AGTACTGCCCCTCTGGTCTCTGG + Intergenic
1149742228 17:59057502-59057524 AATACTGCTCTTTTTCTGGCCGG - Intronic
1152746018 17:82039717-82039739 ACTACTGCCCTTCTGTGGCCAGG + Intergenic
1160106200 18:75979324-75979346 ATTCCAGCCCTTTTGCTGTCTGG - Intergenic
1161390759 19:4019186-4019208 AAACCTGCCCTTCTGCCCTCGGG - Intronic
1202702475 1_KI270712v1_random:174942-174964 AATGCTGCCCTTATGCTGTCGGG + Intergenic
927185992 2:20482935-20482957 AATACTTTCCTTCTGCTTTTTGG - Intergenic
928065943 2:28164643-28164665 AATTCTGCCCAGCTGCTTTCTGG + Intronic
929076108 2:38080199-38080221 AGCTCTGCCCTTCTGCTGTCAGG + Intronic
930410409 2:51018196-51018218 AAGAAAGCCCTTCTGATGTCAGG + Intronic
934173386 2:89558392-89558414 AACGCTGCCCTTATGCTGTCGGG + Intergenic
934283701 2:91632745-91632767 AACGCTGCCCTTATGCTGTCGGG + Intergenic
938746373 2:134282229-134282251 AATAATGGCCTTCTGCCCTCAGG - Intronic
940687009 2:156864446-156864468 AATAAAGCTTTTCTGCTGTCAGG - Intergenic
943264675 2:185713337-185713359 AATAATCCCCTACTGCTTTCTGG + Intergenic
945403197 2:209413457-209413479 GATATTGCCCTTCTGCTTTCTGG + Intergenic
1168918324 20:1509870-1509892 CATTCTGCTCTTCTGCTGCCAGG - Intergenic
1171562948 20:26144515-26144537 AGAAGAGCCCTTCTGCTGTCAGG - Intergenic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1174772041 20:53309215-53309237 ACGACTGCCCTGTTGCTGTCAGG + Intronic
1179057577 21:37950295-37950317 AATACTGAACTTCTGCTCCCAGG + Intergenic
1180000616 21:44993770-44993792 CATACGGCCCTGCTGCTGGCTGG + Intergenic
1180318346 22:11298189-11298211 TGTACTGCTGTTCTGCTGTCAGG + Intergenic
1182149128 22:28016465-28016487 GCTGCTGCCCATCTGCTGTCTGG - Intronic
1182575190 22:31268154-31268176 AAACCTGACCTTCTGCTGCCAGG - Exonic
952616134 3:35276298-35276320 AATGCTGCCCCTCTGTTGTGGGG - Intergenic
955017888 3:55089602-55089624 AACACTGCTCTGCTGCTGACTGG - Intergenic
959564207 3:107817715-107817737 AACAGTGCCCTTCTTCAGTCAGG - Intergenic
960277593 3:115745222-115745244 CATATTGTCCTTCTGTTGTCAGG - Intergenic
961030860 3:123602449-123602471 AAAGCTGTCCTGCTGCTGTCCGG + Intergenic
967734064 3:192933738-192933760 AATAATGCCCATCAGCTCTCTGG + Intergenic
969319469 4:6403030-6403052 ATTACTGCCCTCCTGCCGCCTGG - Intronic
970102195 4:12537489-12537511 CATGCAGCCCTGCTGCTGTCTGG - Intergenic
970274500 4:14383523-14383545 AAAGCTGCCCTTCTTCTGTATGG - Intergenic
971807750 4:31382458-31382480 CATATTGACTTTCTGCTGTCAGG - Intergenic
975541402 4:75515377-75515399 AATATTCCCCTTCAGCTTTCCGG + Intronic
976021719 4:80637418-80637440 AATGCTGCCATTGTGCAGTCTGG - Intronic
978558651 4:110008217-110008239 AAAACTGACCATCTGCTGCCTGG - Exonic
979557591 4:122067246-122067268 CATACTGCCTTTCTGCTCTAAGG - Intergenic
985785345 5:1890311-1890333 AACACTGCCCTTCTGCTGTCAGG - Intergenic
989336584 5:40324333-40324355 AATGATCCCCTGCTGCTGTCTGG + Intergenic
993349816 5:86835897-86835919 AATACTCCTGTTCTGCTTTCGGG - Intergenic
993376589 5:87155860-87155882 ACTACTGCCTTTCTGATCTCAGG - Intergenic
993509615 5:88755106-88755128 AATAGTGCCCTTTTGCTGTGAGG + Intronic
993661644 5:90645006-90645028 AATACTGCTCTTCTGGTTTATGG - Intronic
995872010 5:116753539-116753561 AGTACTGGCCTTCTGATCTCAGG + Intergenic
998398423 5:141834743-141834765 AAAACAGGACTTCTGCTGTCTGG + Intergenic
998461990 5:142316671-142316693 GATCCTGCCCCTCTGCTGTTAGG + Intronic
998915837 5:147010694-147010716 CCTACTGCCCTCCTGCTGTGTGG + Intronic
1001130463 5:169059482-169059504 ATCACTGCCCTTCTACTTTCTGG - Intronic
1003127194 6:3364714-3364736 CATGCTGCGCTTCTCCTGTCAGG - Intronic
1003650153 6:7951909-7951931 ATTTCTGAGCTTCTGCTGTCGGG - Intronic
1009535540 6:64878261-64878283 CCTACTGCCCTACTGCTGTATGG - Intronic
1010997860 6:82554010-82554032 TATCCTGCTCTTCTGCTGGCAGG - Intergenic
1020679831 7:11222691-11222713 AACCCTGGGCTTCTGCTGTCAGG - Intergenic
1025610549 7:63072663-63072685 AAGACTGCCCTTCGGCTCCCTGG + Intergenic
1026635506 7:72078433-72078455 GATACTGCTCATCTGCTGCCAGG - Intronic
1031935608 7:127732540-127732562 ACTGCTGCCCTTTAGCTGTCTGG + Intronic
1032616972 7:133483369-133483391 AATATTGCCCTTGAGCTCTCTGG + Intronic
1033479422 7:141724787-141724809 CTTACTGCCATTTTGCTGTCAGG - Intronic
1034334515 7:150312152-150312174 AATACTGGCCTTCTGGAGTGGGG - Intronic
1035975538 8:4306736-4306758 AACACTACCCTGCTGCGGTCGGG - Intronic
1040608719 8:48961340-48961362 ATTACCTCCCTTCTGCTTTCTGG - Intergenic
1041981999 8:63872946-63872968 AATGTGGCCCTTCTGCTGCCTGG + Intergenic
1044365148 8:91336320-91336342 AATGCTCACCTTCTGCTGTGTGG - Intronic
1047148275 8:122230716-122230738 AATACTCACCTCCTGCTGTGTGG + Intergenic
1050412777 9:5383735-5383757 AATACTGCCCTTGATCTGGCAGG + Intronic
1053122163 9:35555501-35555523 ACTCCTGTCCTTCTGCTGTCCGG + Exonic
1056596436 9:88011634-88011656 AATACTGCCAATGTGCTGGCAGG + Intergenic
1058765284 9:108176482-108176504 AATACTGACCTTCTGAGGTCAGG - Intergenic
1058779277 9:108317128-108317150 ACTACTGACCTCCTGCTGTGTGG - Intergenic
1060807435 9:126586473-126586495 ACCACTGCCCTTCTGGTGTCAGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1188114113 X:26223032-26223054 AAGACTTCCCTTTTGCTGACTGG - Intergenic
1188995613 X:36881572-36881594 ACTATTGCCCTTCTCCTGTAAGG + Intergenic
1191945709 X:66532825-66532847 AATCCTGCCATTCTACTTTCAGG - Intergenic
1194696062 X:97052550-97052572 AATACAGCTCTGCTCCTGTCTGG - Intronic
1194865538 X:99061370-99061392 GATTCTGCTGTTCTGCTGTCAGG + Intergenic
1200359223 X:155584893-155584915 AATACTGTCATTTTGCTTTCAGG - Intronic