ID: 1072299726

View in Genome Browser
Species Human (GRCh38)
Location 10:94047583-94047605
Sequence CAATTTCTGCAAAGTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 670}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072299726_1072299729 7 Left 1072299726 10:94047583-94047605 CCTTCTACACTTTGCAGAAATTG 0: 1
1: 0
2: 2
3: 41
4: 670
Right 1072299729 10:94047613-94047635 CATCTGTTGATGTGAGGCAAAGG No data
1072299726_1072299727 1 Left 1072299726 10:94047583-94047605 CCTTCTACACTTTGCAGAAATTG 0: 1
1: 0
2: 2
3: 41
4: 670
Right 1072299727 10:94047607-94047629 TGCCAGCATCTGTTGATGTGAGG No data
1072299726_1072299731 9 Left 1072299726 10:94047583-94047605 CCTTCTACACTTTGCAGAAATTG 0: 1
1: 0
2: 2
3: 41
4: 670
Right 1072299731 10:94047615-94047637 TCTGTTGATGTGAGGCAAAGGGG No data
1072299726_1072299730 8 Left 1072299726 10:94047583-94047605 CCTTCTACACTTTGCAGAAATTG 0: 1
1: 0
2: 2
3: 41
4: 670
Right 1072299730 10:94047614-94047636 ATCTGTTGATGTGAGGCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072299726 Original CRISPR CAATTTCTGCAAAGTGTAGA AGG (reversed) Intronic
900118561 1:1039014-1039036 CAGTATCTGCAAAGCTTAGAGGG - Intronic
900511466 1:3062968-3062990 CAAATCCTGCAGAGTGTGGAGGG - Intergenic
900608226 1:3533272-3533294 CCATTTCTGCAGAGTGTTGGGGG - Intronic
900994975 1:6116665-6116687 GAATATCTGCAAAGTGCTGAGGG + Intronic
903197059 1:21698437-21698459 CAATTTTTTCAAAGTGTATGTGG - Intronic
903399206 1:23027377-23027399 CAAATTGTGCAAAAGGTAGAAGG + Intronic
903566701 1:24272841-24272863 CAGTTTCTTCATAGTGTTGATGG + Intergenic
906739751 1:48171393-48171415 CAGTTTCTTCATAGTGTTGATGG + Intergenic
906881889 1:49600688-49600710 CAGTTTCTTCATAGTGTCGATGG + Intronic
908059108 1:60327437-60327459 CAGTTTCTTCATAGTGTCGATGG + Intergenic
908584410 1:65552794-65552816 CAGTTTCTTCATAGTGTTGATGG + Intronic
908601208 1:65742281-65742303 CAATTTTTTCATAGTGTTGATGG + Intergenic
908916484 1:69132482-69132504 GAATTTGTGCAAAATATAGAAGG + Intergenic
909379242 1:74978770-74978792 TAATATCTTCAAAGTGTTGAGGG + Intergenic
909575880 1:77175600-77175622 AAATTTTTGCCTAGTGTAGAGGG + Intronic
910383865 1:86660437-86660459 CATTTAAAGCAAAGTGTAGAGGG + Intergenic
910605056 1:89073911-89073933 CAGTTTCTTCATAGTGTTGATGG - Intergenic
910649967 1:89556088-89556110 CAACTTCTGGAAAGGGGAGAGGG + Intronic
910912748 1:92254824-92254846 CAGTTTCTTCATAGTGTCGATGG - Intronic
910925182 1:92390457-92390479 CAGTTTCTTCATAGTGTTGATGG - Exonic
910957064 1:92717607-92717629 CAGTTTCTTCATAGTGTCGATGG - Intronic
911495226 1:98623304-98623326 CAGTTTCTTCATAGTGTCGATGG + Intergenic
911632880 1:100201968-100201990 CAGTTTCTTCATAGTGTCGATGG - Intronic
912007110 1:104917705-104917727 CAGTTTCTTCATAGTGTCGATGG - Intergenic
912235549 1:107846361-107846383 CAGTTTCTTCACAGTGTTGATGG - Intronic
912966943 1:114243851-114243873 CAGTTTCTTCATAGTGTTGATGG - Intergenic
913036078 1:114967760-114967782 CAGTTTCTTCATAGTGTTGATGG + Intronic
913078715 1:115361983-115362005 CAGTTTCTGCATAGTGTCGATGG - Intergenic
914855433 1:151346969-151346991 CGGTTTCTGCAAAGTGGAGCGGG + Intronic
915651758 1:157317327-157317349 CAGTTTCTTCATAGTGTCGACGG - Intergenic
915876737 1:159618437-159618459 CAGTTTCTTCATAGTGTTGATGG - Intergenic
915992049 1:160528026-160528048 CAGTTTCTTCATAGTGTCGATGG + Intergenic
916240811 1:162637470-162637492 GAAATTGTGCAAAGGGTAGAAGG - Intronic
916612608 1:166408013-166408035 CAGTTTCTTCATAGTGTTGATGG + Intergenic
916614645 1:166427535-166427557 CAGTTTCTTCATAGTGTCGATGG + Intergenic
916938751 1:169658317-169658339 CAGTTTCTTCATAGTGTCGACGG - Intergenic
917009532 1:170455803-170455825 CAGTTTCTTCATAGTGTCGATGG + Intergenic
917019594 1:170571240-170571262 CAGTTTCTTCATAGTGTCGATGG - Intergenic
917707101 1:177645776-177645798 CATTTTGTGCAAAGTGCAGAAGG + Intergenic
917854673 1:179090742-179090764 CCACTTCTGCCAAGTATAGAAGG + Intronic
917900579 1:179539268-179539290 CAGTTTCTTCATAGTGTCGATGG + Intronic
917915447 1:179696395-179696417 CAGTTTCTTCATAGTGTCGATGG - Intergenic
918353550 1:183683248-183683270 CAGTTTCTTCATAGTGTTGATGG + Intronic
918501278 1:185199327-185199349 CAGTTTCTTCATAGTGTCGATGG + Intronic
918504279 1:185234690-185234712 CAGTTTCTTCATAGTGTCGATGG + Intronic
919223380 1:194660943-194660965 CAGTTTCTTCATAGTGTCGATGG - Intergenic
919288664 1:195600060-195600082 GAATTTCTTCACAGTGGAGAAGG - Intergenic
919411108 1:197244253-197244275 CAGTTTCTTCAAAGTATGGATGG + Intergenic
919531417 1:198725887-198725909 CAATTTCAACAAGTTGTAGAAGG - Intronic
919602114 1:199634911-199634933 CAGTTTCTTCATAGTGTTGATGG - Intergenic
919718043 1:200800742-200800764 CAGTTTCTTCATAGTGTCGATGG + Intronic
920206952 1:204299204-204299226 CCATGTGTGCAAAGTCTAGATGG - Intronic
920771259 1:208888342-208888364 CCATTTCTCTAAAGTGAAGATGG + Intergenic
922470595 1:225874772-225874794 AATTTTCTGTAAAGTGAAGAAGG - Intronic
923061026 1:230474709-230474731 CAGTTTCTTCATAGTGTTGATGG + Intergenic
923131701 1:231080572-231080594 CAGTTTCTTCATAGTGTCGATGG + Intergenic
923803343 1:237231929-237231951 CAATTGCTGTAATGTGTAGGTGG + Intronic
924094809 1:240540353-240540375 CAATTGCTGCCAAGTGAAGAAGG + Intronic
924296246 1:242589013-242589035 CAATTTCTTCATAGTGTCGATGG - Intergenic
924398634 1:243652511-243652533 CAGTTTCTTCATAGTGTTGATGG - Intronic
924868321 1:248011030-248011052 CAGTTTCTTCATAGTGTCGATGG + Intronic
1064492678 10:15876595-15876617 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1065020553 10:21498940-21498962 AAAATTCTGGAAAGTATAGAGGG + Intergenic
1066257438 10:33694376-33694398 CAATTTCTTCATAATGTTGATGG + Intergenic
1068085877 10:52373309-52373331 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1068516810 10:58035420-58035442 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1068641410 10:59412410-59412432 CAGTTTCTGCATAGCGTCGATGG + Intergenic
1068785956 10:60973812-60973834 GAATTTCTTCAAAGTGAGGAGGG + Intronic
1068951789 10:62784373-62784395 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1069139718 10:64808524-64808546 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1069494669 10:68892647-68892669 AATTTTCTGCAAAATGTCGAAGG + Exonic
1069779655 10:70946687-70946709 CAGTTTCTGCCAAGTCTAGGTGG + Intergenic
1070001860 10:72384379-72384401 CAATATCGGGAAAGTGTAGAGGG - Intronic
1071139515 10:82491548-82491570 AAATTTCTGCAAAGTTAAGATGG - Intronic
1071467360 10:85953584-85953606 CAGATTCTGCAAAGTGGAGAAGG - Intronic
1071844538 10:89507641-89507663 CAGTTTCTTCATAGTGTTGATGG - Intronic
1072299726 10:94047583-94047605 CAATTTCTGCAAAGTGTAGAAGG - Intronic
1072493491 10:95932458-95932480 CAATTTCTTCATAGTGTCAATGG + Intronic
1073884380 10:108021160-108021182 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1076107757 10:127837156-127837178 CAATTTCTGGCAAGTGTCCAAGG - Intergenic
1076123896 10:127959665-127959687 CACTTTCTCCATAGTGTTGAGGG + Intronic
1076164527 10:128271078-128271100 TTATTTCTACAAAGTGTACAGGG + Intergenic
1076397602 10:130152383-130152405 CAGTTTCTTCATAGTGTCGATGG + Intronic
1077561837 11:3268490-3268512 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1077567731 11:3314310-3314332 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1077967247 11:7148084-7148106 CAGTTTCTTCATAGTGTTGACGG + Intergenic
1078049739 11:7952900-7952922 TAATTTCTTCTAAATGTAGAAGG + Intergenic
1078054530 11:7996642-7996664 CAATTTAAGCAAAGACTAGATGG + Exonic
1078331273 11:10424171-10424193 CAGTTTCTTCATAGTGTCGATGG + Intronic
1078468344 11:11567476-11567498 CAATTTCTGGCAAGTGGTGAGGG + Intronic
1078809220 11:14741667-14741689 CAGTTTCTTCATAGTGTCGATGG + Intronic
1078833014 11:14994213-14994235 CAGTTTCTTCAAAGTGTCAATGG - Intronic
1078998573 11:16729642-16729664 CAGTTTCTTCATAGTGTCGATGG - Intronic
1079195142 11:18319683-18319705 CAATTTCTGTAAAGTGCTGTGGG + Intronic
1079603511 11:22340241-22340263 AAATATCTGCAAATTGTAAACGG + Intronic
1079868116 11:25760356-25760378 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1081252127 11:40849219-40849241 CAATTTCTTCATAGTGTCAATGG + Intronic
1083650855 11:64203887-64203909 CAAGTTCTGCGAAGTGGAGCAGG + Intronic
1084586680 11:70066571-70066593 AAATGTCTGCAATGTGTTGAGGG + Intergenic
1085213669 11:74807427-74807449 ATACTTCTGCAAGGTGTAGAAGG - Intronic
1086055419 11:82640588-82640610 CAATGTCTGCAAGGTGCTGATGG + Intergenic
1086085826 11:82954440-82954462 CAGTTTCTTCATAGTGTCGATGG + Intronic
1086349086 11:85926651-85926673 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1086475533 11:87169380-87169402 CAGTTTCTTCATAGTGTCGATGG + Intronic
1086555686 11:88108721-88108743 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1086783334 11:90934407-90934429 TAATTTCTCCGAAGTTTAGAGGG - Intergenic
1086906929 11:92429458-92429480 CAGTTTCTTCATAGTGTTGATGG + Intronic
1087331890 11:96791608-96791630 CAGTTTCTTCACAGTGTCGATGG + Intergenic
1087410330 11:97783536-97783558 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1087830767 11:102817968-102817990 CAGTTTCTTCATAGTGTAGGTGG + Intergenic
1087868471 11:103262764-103262786 CAGTTTCTTCATAGTGTTGATGG - Intronic
1088151954 11:106756426-106756448 CAGTTTCTTCATAGTGTTGATGG + Intronic
1088729133 11:112665336-112665358 AAATTTCAGTAAAGTGGAGAAGG - Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089765816 11:120764522-120764544 CAGTTTCTTCATAGTGTTGATGG + Intronic
1090895904 11:130975166-130975188 CAATTTCTTCATAGTGCTGATGG + Intergenic
1091962710 12:4711983-4712005 CAATTTCTAAAAAGACTAGAAGG - Intronic
1092398705 12:8152831-8152853 CAGTTTCTTCATAGTGTTGATGG + Intronic
1093248748 12:16773122-16773144 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1093595446 12:20953165-20953187 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1093902595 12:24653164-24653186 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1093953860 12:25194848-25194870 CAGTTTCTGCAAACGGGAGATGG - Intronic
1094239846 12:28209802-28209824 AAATTTTTGCAAAGTTTAAAGGG - Intronic
1094791314 12:33918980-33919002 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1095406508 12:41872213-41872235 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1095488715 12:42710210-42710232 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1095832146 12:46599661-46599683 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1096942053 12:55357293-55357315 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1097517370 12:60621804-60621826 CAATTTCTTCATAGTGTTGATGG - Intergenic
1097619716 12:61924652-61924674 CACTTTCTTCATAGTGTCGATGG - Intronic
1097634994 12:62112066-62112088 CAGTTTCTTCATAGTGTCGATGG + Intronic
1098151646 12:67553778-67553800 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1098992825 12:77083948-77083970 CAAATTATGTAAAATGTAGAAGG - Intergenic
1099010756 12:77288258-77288280 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1099137803 12:78930226-78930248 AACTTTCTGCAATGTATAGATGG + Intronic
1099216846 12:79863380-79863402 CAGTTTCTTCATAGTGTCGATGG - Intronic
1099492268 12:83301806-83301828 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1099574081 12:84359481-84359503 CAATTTCTCCAAAGATGAGAAGG - Intergenic
1099697271 12:86038810-86038832 CAGTTTCTTCATAGTGTTGATGG + Intronic
1099715239 12:86284820-86284842 CAATTTCTGTTAATTTTAGATGG + Intronic
1099897742 12:88669517-88669539 CAATTTCTTCATAGTGTTGATGG - Intergenic
1100356518 12:93836161-93836183 TAATTTCAGCAGAGTGGAGATGG - Intronic
1100443068 12:94635456-94635478 CAGTGTTTGCAAACTGTAGAAGG + Intronic
1100740254 12:97583448-97583470 CAGTTTCTCCATAGTGTTGATGG - Intergenic
1100768521 12:97896371-97896393 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1101296352 12:103427021-103427043 CAGTTTCTTCAGAGTGTTGATGG - Intronic
1101472452 12:105011568-105011590 CAGTTTCTTCATAGTGTTGATGG + Intronic
1101783601 12:107861892-107861914 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1105244149 13:18632916-18632938 TAATTTCTTCATAGTGTCGATGG - Intergenic
1105316725 13:19272205-19272227 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1105392172 13:19990401-19990423 CAGCTTCTGCAAAGCCTAGAGGG - Intronic
1105645583 13:22314518-22314540 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1106367590 13:29097283-29097305 CAATTTCTGGAAACTTTAAATGG + Intronic
1106429642 13:29667638-29667660 CAGTTTCTTCACAGTGTCGATGG - Intergenic
1106612089 13:31293885-31293907 CAGTTTCTTCATAGTGTCGAAGG + Intronic
1107212571 13:37874888-37874910 CAATTTGTGCAAAGTAGAGGTGG + Intergenic
1107923960 13:45240078-45240100 CAATTTCTGTATTATGTAGAGGG + Intronic
1108029863 13:46218680-46218702 CAGTTTCTTCATAGTGTTGATGG + Intronic
1108384066 13:49881775-49881797 CAGTTTCTTCACAGTGTTGATGG - Intergenic
1108425776 13:50298430-50298452 CAGTTTCTTCAAAATGTCGATGG + Intronic
1108673816 13:52719405-52719427 CAGTTTCTTCATAGTGTTGATGG + Intronic
1108873036 13:55009917-55009939 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1109034057 13:57231989-57232011 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1109675734 13:65673886-65673908 CAGTTTCTTCATAGTGTTGAAGG + Intergenic
1109902595 13:68793963-68793985 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1110199507 13:72832343-72832365 CAGTTTCTTCATAGTGTCGATGG + Intronic
1111080938 13:83306599-83306621 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1111791836 13:92866926-92866948 CCATTTTTGCAAGCTGTAGAAGG + Exonic
1112424585 13:99286106-99286128 CAATTGCTGAAAAGGCTAGAAGG - Intronic
1112546375 13:100375706-100375728 CAGTTTCTTCATAGTGTTGATGG - Intronic
1115033150 14:28822904-28822926 CACTTTCACCAAAGTGTACAAGG - Intergenic
1115276846 14:31619363-31619385 CAGTTTCTTCATAGTGTCGATGG + Intronic
1115720885 14:36160305-36160327 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1115728825 14:36245858-36245880 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1115856049 14:37631189-37631211 CAGTTTCTTCATAGTGTTGATGG + Intronic
1116771246 14:49129850-49129872 CAATTTCTTCATAGTGTCGATGG + Intergenic
1116792923 14:49358641-49358663 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1117238187 14:53800234-53800256 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1117502146 14:56363662-56363684 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1117550431 14:56830744-56830766 CAATCACTGCAAAATGTAGAGGG - Intergenic
1117616868 14:57543172-57543194 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1117822070 14:59659803-59659825 CAGTTTCTTCATAGTGTCGATGG - Intronic
1117930326 14:60835325-60835347 CAGTTTCTTCATAGTGTTGATGG + Intronic
1118070556 14:62242708-62242730 GAATATCAGCAAAGTGTTGAAGG + Intergenic
1118544922 14:66875320-66875342 CAGTTTCTTCACAGTGTCGATGG - Intronic
1120603396 14:86540900-86540922 CAATTTCCTGCAAGTGTAGAAGG + Intergenic
1120770309 14:88371932-88371954 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1122733254 14:103818309-103818331 GAAATTCTACAAATTGTAGATGG - Intronic
1124084417 15:26533418-26533440 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1124666944 15:31600523-31600545 CAGTTTCTTCATAGTGTTGATGG - Intronic
1125219728 15:37319166-37319188 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1125329789 15:38571685-38571707 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1126051044 15:44685160-44685182 CAGTTTCTTCATAGTGTTGATGG - Intronic
1126470544 15:49005831-49005853 CAGTTTCTTCATAGTGTTGACGG + Intronic
1126769059 15:52036924-52036946 CATTTTCTCCAAACTGAAGAAGG - Intronic
1127580238 15:60331826-60331848 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1127646341 15:60963152-60963174 CAATTTCTTCGAAGCGTAAATGG - Intronic
1128431507 15:67599478-67599500 CAACTTCAGAAATGTGTAGAAGG + Intronic
1128852301 15:70972062-70972084 CAGTTTCTTCATAGTGTCGATGG + Intronic
1129369611 15:75081991-75082013 CAATTTCTGCAAAAAGAAGCTGG - Intronic
1129498940 15:76017418-76017440 CAGTTTCTTCATAGTGTCGATGG + Intronic
1129563432 15:76594890-76594912 CAATTTCTTCGTAGTGTTGATGG - Intronic
1130209615 15:81911148-81911170 CGGTTTCTGCAAAGTGCAGTTGG + Intergenic
1130287043 15:82564739-82564761 CAATTTCTTCAAAGAGAAAAAGG + Intronic
1131302055 15:91208241-91208263 CAGTTTTTGCAAAATGCAGAGGG - Intronic
1131680140 15:94712943-94712965 CAGTTTCTACAAAGTGGAGCAGG - Intergenic
1137336223 16:47552292-47552314 CAGTTTCTTCATAGTGTCGATGG + Intronic
1137846160 16:51690272-51690294 CAAGTTCTCAAAAGTGTAGTAGG - Intergenic
1138843434 16:60537348-60537370 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1140713068 16:77695947-77695969 CAATTTGTGCAAATTGAAAATGG + Intergenic
1140725704 16:77809665-77809687 CAATTGCTGCTATGGGTAGAGGG + Intronic
1140883615 16:79222400-79222422 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1143426924 17:6847267-6847289 CAATTTCTTCATAGTGTCGATGG + Intergenic
1143753800 17:9051477-9051499 CACATACTGCAAAGTGGAGAGGG - Intronic
1146746112 17:35332011-35332033 CAGTTTCTTCAGAGTGTCGATGG + Intergenic
1147525487 17:41218210-41218232 CAGTTTCTTCATAGTGTCGATGG - Intronic
1148967611 17:51449056-51449078 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1148981251 17:51576763-51576785 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1149351989 17:55799652-55799674 CAGTTTCTTCATAGTGTTGATGG + Intronic
1150546001 17:66157441-66157463 CAGTTTCTTCATAGTGTCGATGG - Intronic
1150881693 17:69036593-69036615 CAATTTCTTCATAGTGTCGTTGG - Intronic
1150884827 17:69072661-69072683 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1151225311 17:72643452-72643474 CAACTTCTGAGCAGTGTAGATGG + Intergenic
1151236613 17:72724704-72724726 GATTTTCTGCCAAGTGCAGAGGG + Intronic
1153702845 18:7713432-7713454 CAGTTTCTTCATAGTGTTGATGG - Intronic
1153743069 18:8149726-8149748 TAATTTCTTCATAGTGTTGATGG + Intronic
1153798675 18:8648785-8648807 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1154312497 18:13278167-13278189 CAGTTTCTGTATAGTGTAAAAGG + Exonic
1155062286 18:22239443-22239465 CAAGTTATGTAAAGTGTGGAGGG - Intergenic
1155385148 18:25268842-25268864 CAATTTCTTCATAGTGTTGATGG - Intronic
1155723776 18:29052962-29052984 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1155899262 18:31367857-31367879 CAATTTCGTCAAAGAGCAGATGG - Intergenic
1156178828 18:34579577-34579599 CAATATCTGCAAAGTATTGAAGG - Intronic
1156188166 18:34688220-34688242 CAGTTTCTTCATAGTGTGGATGG + Intronic
1156414924 18:36878085-36878107 CAGTTTCTTCATAGTGTTGATGG + Intronic
1156626671 18:38918348-38918370 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1157067086 18:44365062-44365084 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1158297464 18:56014631-56014653 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1158425125 18:57333014-57333036 CAATATCTTCAAAGTGTTGTAGG + Intergenic
1159486697 18:69069774-69069796 CAGCTTTTGCAAAGTTTAGAGGG - Intergenic
1159526558 18:69599514-69599536 CAATTTCCTCAAGGGGTAGATGG - Intronic
1159661027 18:71096205-71096227 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1164112944 19:22186445-22186467 CAGTTTCTTCATAGTGTCGATGG - Intronic
1164197213 19:22979922-22979944 CAGTTTCTTCATAGTGTTGATGG - Intronic
1166260462 19:41636769-41636791 CAGTTTCTTCATAGTGTCGATGG + Intronic
1167973885 19:53208401-53208423 CAGTTTCTTCATAGTGTCGATGG + Intergenic
924967956 2:95371-95393 CAGTTTCTTCACAGTGTTGACGG - Intergenic
925448148 2:3945597-3945619 CAAATTCTGAAAAGTCTTGAAGG - Intergenic
925484293 2:4311444-4311466 CAATTTCTTCACAGTGTCAATGG + Intergenic
925566389 2:5258690-5258712 CAGTTTCTTCATAGTGTCGATGG - Intergenic
926844860 2:17125079-17125101 CAATTTCAGTAAATTGTAAAAGG + Intergenic
927336589 2:21931689-21931711 CAATTTCTTCATAGCGTCGATGG + Intergenic
927610497 2:24534601-24534623 CATTTAAAGCAAAGTGTAGAGGG - Intronic
928750875 2:34468571-34468593 CAGTTTCTTCATAGTGTTGATGG - Intergenic
929062696 2:37939960-37939982 CAGTTTCTTCATAGTGTGGATGG + Intronic
929255916 2:39811768-39811790 CAGTTTCTTCATAGTGTTGATGG + Intergenic
930057892 2:47265787-47265809 CAATCTCTGCATAGTGGAGTAGG - Intergenic
930264513 2:49184577-49184599 CAGTTTCTTCATAGTGTTGATGG + Intergenic
930689914 2:54350862-54350884 TAATATCTTCAAAGTGTAAAGGG - Intronic
931030591 2:58170449-58170471 CAGTTTCTTCATAGTGTTGATGG - Intronic
931164111 2:59727285-59727307 GACTTTCTGAAAAGAGTAGAAGG - Intergenic
931732342 2:65164441-65164463 CACTGTCTACTAAGTGTAGAAGG + Intergenic
932437295 2:71710040-71710062 CAATTTCAGCAAAGTGTTTTGGG - Intergenic
932511581 2:72298564-72298586 CAGTTTCTTCACAGTGTCGATGG + Intronic
934199420 2:89871144-89871166 GAGTTTTTGCAACGTGTAGATGG + Intergenic
935010732 2:99133664-99133686 CAGTTTCTTCATAGTGTTGATGG + Intronic
935567742 2:104627780-104627802 CAGTTTCTTCATAGTGTTGACGG + Intergenic
935961694 2:108431424-108431446 CAGTTTCTTCATAGTGTGGATGG - Intergenic
936257358 2:110928410-110928432 GAATTTCTGTAAACTGTGGAGGG - Intronic
936437558 2:112521464-112521486 CAATTTCTTCAAGATGTAGATGG - Intronic
936701184 2:115013074-115013096 CAGTTTCTTCATAGTGTCGATGG + Intronic
937464812 2:122123228-122123250 CAATTTCTTCATAGTGTCAATGG + Intergenic
938874204 2:135516345-135516367 AAATTTCTTCACAGTGTTGATGG + Intronic
939116690 2:138069414-138069436 CAGTTTCTTCATAGTGTCGATGG + Intergenic
939383638 2:141467692-141467714 AAATATCTGCAATGTGCAGAAGG - Intronic
939653032 2:144787331-144787353 CAGTTTCTTCATAGTGTCGATGG - Intergenic
939686932 2:145211905-145211927 CAGTTTCTTCAGAGTGTCGACGG + Intergenic
939876483 2:147584519-147584541 CAGTTTCTTCATAGTGTAAATGG + Intergenic
939937548 2:148311727-148311749 CAGTTTCTTCATAGTGTCGATGG + Intronic
939947137 2:148423613-148423635 CAGTTTCTTCATAGTGTCGATGG - Intronic
940084089 2:149838522-149838544 CAGTTTCTACATAGTGTTGATGG + Intergenic
940302917 2:152194341-152194363 CAGTTTCTTCATAGTGTCGATGG - Intergenic
940407839 2:153326564-153326586 CAGTTTCTTCATAGTGTCGATGG + Intergenic
940758159 2:157706527-157706549 CAGTTTCTTCATAGTGTTGATGG - Intergenic
940808045 2:158209874-158209896 CAGTTTCTTCATAGTGTCGATGG - Intronic
940925380 2:159358026-159358048 CAGTTTCTTCATAGTGTCGATGG - Intronic
940999238 2:160183055-160183077 CATTTTCTTCATAGTGTCGACGG - Intronic
941522740 2:166568170-166568192 TAATATCTTCAAAGTGTTGAGGG + Intergenic
941559842 2:167031271-167031293 CAGTTTCTTCATAGTGTTGATGG + Intronic
941682113 2:168411120-168411142 CAGTTTCTTCATAGTGTCGATGG + Intergenic
941845520 2:170127971-170127993 CAGTTTCTTCACAGTGTTGATGG - Intergenic
942010656 2:171759584-171759606 CAGTTTCTTCATAGTGTTGATGG + Intergenic
943001281 2:182331426-182331448 CAGTTTCTTCATAGTGTCGATGG + Intronic
943130174 2:183843940-183843962 CAGTTTCTTCATAGTGTTGATGG - Intergenic
943552268 2:189355855-189355877 CAGTTTCTTCATAGTGTCGATGG + Intergenic
943598889 2:189890992-189891014 CAATTTCTTCATAGTGTCGATGG + Intronic
943891809 2:193296872-193296894 CAGTTTCTTCATAGTGTTGATGG - Intergenic
944169216 2:196756703-196756725 CAGTTTCTTCATAGTGTCGATGG + Intronic
944378187 2:199073617-199073639 CAGTTTCTTCATAGTGTCGATGG - Intergenic
944455423 2:199888639-199888661 CAGTTTCTTCATAGTGTTGATGG - Intergenic
944644187 2:201762035-201762057 GAATTTCTACAAAGTGCAGGAGG + Intronic
944925825 2:204463503-204463525 CAGTTTCTTCATAGTGTCGATGG + Intergenic
945207449 2:207346505-207346527 CAGTTTCTTCATAGTGTCGATGG - Intergenic
945409397 2:209490339-209490361 CAGTTTCTTCATAGTGTCGATGG - Intronic
945613555 2:212037210-212037232 AAAACTCAGCAAAGTGTAGAAGG + Intronic
945845723 2:214942037-214942059 CAGTTTCTTCATAGTGTTGATGG + Intronic
945945427 2:215990458-215990480 CAGTTTCTTCATAGTGTCGATGG - Intronic
946100887 2:217321515-217321537 GAATTTCTGAAAAGAGAAGATGG - Intronic
946680803 2:222213682-222213704 AAATTCCTGGAAAGTGTAAAGGG + Intronic
947304705 2:228731290-228731312 AAATTTCTGCACATTGTTGATGG - Intergenic
1170237017 20:14118275-14118297 GTATTTCTTCAAAGTTTAGAAGG + Intronic
1170283272 20:14675617-14675639 CAGTTTCTTCATAGTGTTGATGG - Intronic
1170973321 20:21137320-21137342 CAAATTATGCCAAGTGTGGAGGG + Intronic
1171001074 20:21415885-21415907 CAGTTTCTTCAAAGTGTCGATGG - Intergenic
1171141768 20:22749726-22749748 CAATATCTGCGAAGGGTAGAGGG + Intergenic
1173072044 20:39777565-39777587 CTTTATCTACAAAGTGTAGATGG - Intergenic
1173141567 20:40489466-40489488 CAAGTTGAGCAAAGGGTAGATGG - Intergenic
1173239461 20:41281179-41281201 CAATTTCTACAAAGTTTAAAAGG + Intronic
1173750940 20:45476253-45476275 CAGTTTCTTCATAGTGTCGATGG + Intronic
1174439866 20:50542075-50542097 CAAGTTATGCCAAGTGTTGATGG - Intronic
1176451193 21:6862885-6862907 TAATTTCTTCATAGTGTAGATGG - Intergenic
1176829362 21:13727936-13727958 TAATTTCTTCATAGTGTAGATGG - Intergenic
1176891993 21:14329214-14329236 CAATTTCTTCATAGTGTTGATGG - Intergenic
1177932600 21:27303378-27303400 CAATTTCTGCAAACTGAAATTGG - Intergenic
1179899284 21:44380672-44380694 CAACTCCTCCACAGTGTAGACGG - Intronic
949453524 3:4213475-4213497 CAGTTTCTTCATAGTGTTGATGG - Intronic
949580381 3:5382373-5382395 CAGTTTCTTCATAGTGTTGATGG + Intergenic
949801002 3:7904422-7904444 CAGTTTCTTCATAGTGTCGATGG + Intergenic
950596578 3:13989199-13989221 CAATTTCTTCATAGTGTCAATGG + Intronic
950992240 3:17451292-17451314 CAGTTTCTTCATAGTGTTGATGG - Intronic
951254278 3:20431191-20431213 CAGTTTCTTCACAGTGTTGATGG + Intergenic
951450172 3:22828384-22828406 CAGTTTCTTCATAGTGTCGATGG - Intergenic
953047445 3:39306592-39306614 CAGTTTCTTCATAGTGTCGATGG - Intergenic
953316085 3:41927410-41927432 CAGTTTCTTCACAGTGTTGATGG - Intronic
953895128 3:46792010-46792032 CAGTTTCTTCATAGTGTCGACGG - Intronic
954490398 3:50899555-50899577 CAGTTTCTTCATAGTGTTGATGG + Intronic
954507937 3:51095238-51095260 CAGTTTCTTCATAGTGTGGATGG + Intronic
955174883 3:56604355-56604377 CAGTTTCTTCATAGTGTCGATGG + Intronic
955908662 3:63835031-63835053 CAATTTCTGAACAGTGTAGCTGG - Intronic
955917159 3:63917974-63917996 CCCTTTCTGGAAAGTGTAAATGG - Intronic
956279626 3:67542393-67542415 CAGTTTCTTCATAGTGTTGATGG - Intronic
956355932 3:68391922-68391944 CAGTTTCTTCATAGTGTTGATGG - Intronic
956382844 3:68684507-68684529 CAATTTCTTCATAGTGTTGATGG + Intergenic
956396412 3:68831266-68831288 CAGTTTCTTCACAGTGTCGATGG + Intronic
956640662 3:71412553-71412575 CATTTTCTTCAAAGGGTAGTTGG - Intronic
957249872 3:77758819-77758841 CAGTTTCTTCATAGTGTCGATGG - Intergenic
957908021 3:86582722-86582744 CAGTTTCTTCATAGTGTTGATGG - Intergenic
957993030 3:87651950-87651972 CAATTTCTTCATAGTGTAGATGG + Intergenic
958056900 3:88424565-88424587 CAATTACTGCAAACTGTGCAAGG + Intergenic
958434305 3:94079006-94079028 CAGTTTCTTCATAGTGTCGATGG + Intronic
959290503 3:104467899-104467921 CAGTTTCTTCATAGTGTTGATGG + Intergenic
959428464 3:106222474-106222496 CAGTTTCTTCATAGTGTTGATGG + Intergenic
959843086 3:111000673-111000695 CAGTTTCTTCATAGTGTCGATGG - Intergenic
960177505 3:114534051-114534073 CAGTTTCTTCATAGTGTCGATGG - Intronic
960294385 3:115925164-115925186 CTATTTTTGGAGAGTGTAGAGGG + Intronic
960377931 3:116926400-116926422 CAGTTTCTTCATAGTGTCGATGG + Intronic
960770178 3:121185122-121185144 CAGTTTCTTCAGAGTGTCGATGG - Intronic
961310804 3:125998610-125998632 CAGTTTCTTCATAGTGTCGATGG - Intergenic
961977740 3:131044161-131044183 CAGTTTCTCCATAGTGTTGATGG - Intronic
962239184 3:133736367-133736389 CAGTTTCTTCATAGTGTTGATGG - Intergenic
962642155 3:137398900-137398922 CAGTTTCTTCATAGTGTCGATGG + Intergenic
962765975 3:138562768-138562790 CAGTTTCTTCATAGTGTCGATGG - Intronic
963629088 3:147711238-147711260 CAGTTTCTTCACAGTGTTGATGG + Intergenic
963641799 3:147869578-147869600 AAATTTTGGCAAAGTGTTGAAGG - Intergenic
963976526 3:151485864-151485886 CAGTTTCTTCATAGTGTGGATGG - Intergenic
964566863 3:158066170-158066192 CAGTTTCTTCATAGTGTTGATGG - Intergenic
964648874 3:158989661-158989683 CAGTTTCTTCATAGTGTTGATGG + Intronic
964936079 3:162089635-162089657 CAATTTCTCCAAAGTGATAAGGG - Intergenic
965292978 3:166907970-166907992 CAATTTCTTCATAGTGTCTACGG + Intergenic
966291397 3:178363176-178363198 CAGTTTCTTCATAGTGTTGATGG - Intergenic
966753408 3:183344489-183344511 CAGTTTCTTCATAGTGTTGATGG - Intronic
967181273 3:186907589-186907611 CAGTTTCTTCATAGTGTCGATGG + Intergenic
968418218 4:459213-459235 CAGTTTCTTCATAGTGTTGATGG - Intronic
968828832 4:2920914-2920936 CAGTTTCTTCATAGTGTCGATGG + Intronic
969500852 4:7552129-7552151 CATTTTGTTCAAAGTGTAGCAGG - Intronic
970055129 4:11963450-11963472 CAGTTTCTTCATAGTGTTGATGG + Intergenic
970070921 4:12159221-12159243 CAGTTTCTTCATAGTGTCGACGG + Intergenic
970655192 4:18223396-18223418 CAGTTTCTTCATAGTGTTGATGG + Intergenic
971223457 4:24730418-24730440 CTATTTCTGCAAAGAGTTGCTGG + Intergenic
971559791 4:28063298-28063320 AAAATTCTTCAAAGTGAAGAAGG + Intergenic
972339060 4:38135096-38135118 CAGTGTCTGAAAAGTGTACACGG - Intronic
972567241 4:40280740-40280762 CAATTCCAGCCAAGAGTAGAAGG - Intergenic
972962956 4:44475779-44475801 CAGTTTCTTCATAGTGTTGACGG - Intergenic
973003214 4:44977515-44977537 TTATTTCTGCAACGTGTAGCTGG - Intergenic
973556250 4:52086138-52086160 CAATTTCAGAAAAGTGTGTAGGG - Intronic
973683173 4:53342020-53342042 CAGTTTCTTCATAGTGTCGATGG - Intronic
973798608 4:54453232-54453254 CAGTTTCTCCACAGTGTTGATGG - Intergenic
973883746 4:55299190-55299212 CAGTTTCTTCATAGTGTTGATGG - Intergenic
974023871 4:56714676-56714698 CAGTTTCTTCATAGTGTTGATGG - Intergenic
974326105 4:60417449-60417471 CAGTTTCTTCATAGTGTTGATGG + Intergenic
974453098 4:62092413-62092435 CAGTTTCTTCATAGTGTTGATGG + Intergenic
974491421 4:62570017-62570039 CAGTTTCTTCATAGTGTCGATGG + Intergenic
974793220 4:66715970-66715992 CAGTTTCTTCATAGTGTTGATGG - Intergenic
974837811 4:67272259-67272281 CAGTTTCTTCATAGTGTCGATGG + Intergenic
975104338 4:70550655-70550677 CAGTTTCTTCATAGTGTCGATGG - Intergenic
975149192 4:71003035-71003057 CAGTTTCTTCATAGTGTCGATGG + Intronic
975524453 4:75333273-75333295 CAGTTTCTTCATAGTGTTGACGG - Intergenic
976534119 4:86191849-86191871 CAGTTTCTTCATAGTGTCGATGG + Intronic
976655715 4:87487171-87487193 CAGTTTCTTCATAGTGTCGATGG + Intronic
976716147 4:88124226-88124248 CAGTTTCTTCATAGTGTTGATGG - Intronic
977047107 4:92081033-92081055 GAATTTCTTCATAGTGTTGATGG - Intergenic
977154692 4:93557154-93557176 CAGTTTCTTCATAGTGTCGATGG - Intronic
977257462 4:94757454-94757476 CAATTTCTGAAAAGTGTCTATGG + Intergenic
977274049 4:94953339-94953361 CAGTTTCTTCATAGTGTCGACGG + Intronic
977553897 4:98469330-98469352 AAGTTTCTTCAATGTGTAGAAGG - Intergenic
977632760 4:99261877-99261899 CAGTTTCTTCATAGTGTCGAAGG + Intergenic
978124515 4:105119934-105119956 GAATTTAGGCAAAGTGTAGTTGG - Intergenic
978269677 4:106874180-106874202 CAGTTTCTTCATAGTGTTGATGG + Intergenic
978278117 4:106976817-106976839 CAGTTTCTTCAAAGGGTCGATGG + Intronic
978664504 4:111166112-111166134 CAGTTTCTTCATAGTGTTGATGG - Intergenic
978935246 4:114366754-114366776 AAAATTCTGCAAAGTGTTGGTGG + Intergenic
979457816 4:120946134-120946156 CAGTTTCTTCATAGTGTTGATGG - Intergenic
979461413 4:120988768-120988790 CAGTTTCTTCATAGTGTTGATGG + Intergenic
979588026 4:122444388-122444410 CAGTTTCTTCATAGTGTCGATGG + Intergenic
979705495 4:123715101-123715123 TAGTTTCTTCAAAGTGTCGATGG - Intergenic
980026881 4:127778574-127778596 AAACCTCTGCACAGTGTAGAGGG - Intergenic
980157417 4:129124604-129124626 CAGTTTCTTCATAGTGTCGATGG + Intergenic
980260387 4:130440944-130440966 CAGTTTCTTCATAGTGTTGATGG + Intergenic
981296886 4:143142424-143142446 CAGTTTCTTCATAGTGTCGATGG - Intergenic
981629930 4:146806295-146806317 CAGTTTCTTCATAGTGTTGATGG - Intronic
981762860 4:148213095-148213117 CAATTTCTCCAAAGTTGAGAAGG + Intronic
981886261 4:149676543-149676565 CAATTTCTTCATTGGGTAGAGGG - Intergenic
981905533 4:149917453-149917475 CAATTTCTTCCTAGTGTCGATGG - Intergenic
982324099 4:154110846-154110868 CAGTTTCTTCATAGTGTCGATGG - Intergenic
982345423 4:154352472-154352494 CAATTTCTGGTAAATGCAGAGGG + Intronic
982725359 4:158900913-158900935 CAGTTTCTTCATAGTGTTGATGG + Intronic
982733631 4:158981769-158981791 CAGTTTCTTCATAGTGTTGATGG - Intronic
983179653 4:164632500-164632522 CAGTTTCTTCATAGTGTTGATGG - Intergenic
983543515 4:168937374-168937396 CAGTTTCTTCATAGTGTTGATGG - Intronic
983718188 4:170812488-170812510 ACATTTGAGCAAAGTGTAGAGGG + Intergenic
983748461 4:171231811-171231833 CAGTTTCTGCAATGTAGAGAAGG - Intergenic
983754253 4:171314230-171314252 CAGTTTCTTCATAGTGTTGATGG + Intergenic
983949240 4:173620649-173620671 CAGTTTCTTCATAGTGTTGACGG + Intergenic
984167887 4:176324570-176324592 GAATATCTGCATATTGTAGAAGG - Intronic
984577366 4:181466485-181466507 CAATTACCGTAAAGTGTAGGTGG - Intergenic
984618865 4:181929091-181929113 CAGTTTCTTCATAGTGTCGACGG - Intergenic
986700872 5:10407392-10407414 AAATTTATGCAAAGTGGAAAAGG - Intronic
987630332 5:20461809-20461831 CAATTGCTGAAAATTGTTGAGGG - Intronic
987687807 5:21227323-21227345 CAGTTTCTTCATAGTGTTGATGG - Intergenic
987923868 5:24316045-24316067 CAGTTTCTTCACAGTGTTGATGG + Intergenic
987924928 5:24328622-24328644 TAATGTCTGCAAAGTGTGGCTGG + Intergenic
988328555 5:29803892-29803914 CATTTTCTTCAAATGGTAGAAGG + Intergenic
988719419 5:33861095-33861117 CAGTTTCTTCATAGTGTTGATGG - Intronic
989194381 5:38701691-38701713 CAGTTTCTTCACAGTGTCGATGG - Intergenic
989320497 5:40129157-40129179 CAGTTTCTTCATAGTGTTGATGG + Intergenic
989517000 5:42355233-42355255 CAATTTCTTCATAGTGTTGATGG - Intergenic
990163500 5:52969829-52969851 CAGTTTCTTCATAGTGTTGATGG + Intergenic
990195366 5:53309236-53309258 CAGTTTCTTCATAGTGTCGATGG + Intergenic
990232862 5:53733985-53734007 GAATTTCTGCAACATGGAGATGG - Intergenic
990745641 5:58957162-58957184 CAGTTTCTTCATAGTGTTGATGG + Intergenic
990838698 5:60050598-60050620 CAGTTTCTTCATAGTGTTGATGG - Intronic
991025505 5:62025339-62025361 CAGTTTCTTCATAGTGTCGATGG + Intergenic
991223785 5:64245152-64245174 CAGTTTCTTCATAGTGTTGATGG - Intronic
991576047 5:68104290-68104312 CAGTTTCTTCATAGTGTTGATGG - Intergenic
992078086 5:73209131-73209153 CAATTTCTTCATGGTGTAGATGG - Intergenic
992976666 5:82128366-82128388 CAGTTTCTTCATAGTGTTGATGG + Intronic
992977496 5:82136304-82136326 CAGTTTCTTCATAGTGTCGACGG + Intronic
993380644 5:87203270-87203292 CAGTTTCTTCATAGTGTTGACGG + Intergenic
993403909 5:87487689-87487711 CAGTTTCTTCATAGTGTTGATGG + Intergenic
993443208 5:87980589-87980611 CAATTTCTGCAAAGGAAGGATGG + Intergenic
993541833 5:89161248-89161270 CAGTTTCTTCATAGTGTCGATGG - Intergenic
993609222 5:90033578-90033600 CAGTTTCTTCATAGTGTTGATGG - Intergenic
993757425 5:91749289-91749311 CAGTTTCTTCATAGTGTTGACGG + Intergenic
994160523 5:96551481-96551503 CAGTTTCTTCATAGTGTCGATGG - Intronic
994233324 5:97334479-97334501 CAGTTTCTTCATAGTGTCGATGG + Intergenic
994835963 5:104852674-104852696 CAGTTTCTTCACAGTGTGGATGG + Intergenic
995263601 5:110134237-110134259 CAGTTTCTTCATAGTGTCGATGG + Intergenic
995480585 5:112588374-112588396 CAGTTTCTTCATAGTGTCGATGG - Intergenic
995620824 5:114023312-114023334 CAGTTTCTTCATAGTGTTGATGG - Intergenic
995642777 5:114276918-114276940 CAGTTTCTTCATAGTGTCGATGG + Intergenic
995815943 5:116167895-116167917 CAGTTTCTTCATAGTGTCGATGG - Intronic
996130161 5:119771596-119771618 CAGTTTCTTCATAGTGTCGATGG - Intergenic
996286365 5:121797770-121797792 CAAAATCTGCAAACTATAGAAGG + Intergenic
996648330 5:125843070-125843092 CAGTTTCTCCATAGTGTTGATGG - Intergenic
996910673 5:128654049-128654071 CAGTTTCTTCATAATGTAGATGG + Intronic
996953090 5:129151551-129151573 CAATTTCTTCATAGCGTTGATGG + Intergenic
996958082 5:129209509-129209531 CAGTTTCTTCATAGTGTCGATGG + Intergenic
997115349 5:131120907-131120929 CAGTTTCTTCATAGTGTCGATGG + Intergenic
997217636 5:132127489-132127511 CAGTTTCTTCATAGTGTTGATGG + Intergenic
997220147 5:132155504-132155526 CAGTTTCTTCATAGTGTTGATGG + Intergenic
997902971 5:137785002-137785024 CAGTTTCTTCATAGTGTTGATGG - Intergenic
998691405 5:144592825-144592847 CAGTTTCTTCATAGTGTTGATGG + Intergenic
998751887 5:145331848-145331870 CAGTTTCTTCATAGTGTTGATGG + Intergenic
998768427 5:145514058-145514080 CAGTTTCTTCATAGTGTCGATGG - Intronic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
999029845 5:148279357-148279379 CAGTTTCTTCATAGTGTTGATGG + Intronic
999602788 5:153284993-153285015 CAATTTCTTCATAGTTTCGATGG - Intergenic
999829937 5:155308789-155308811 TAATTTCTTCAAGGTGTAAATGG + Intergenic
1000582015 5:163046721-163046743 CAATTTCTTCATAGTGTTGATGG + Intergenic
1000590243 5:163148797-163148819 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1000598051 5:163238201-163238223 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1000831016 5:166101482-166101504 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1001346173 5:170901599-170901621 CAGTTTCTTCATAGTGTCGATGG + Intronic
1002007795 5:176251036-176251058 CAGTTTCTTCATAGTGTTGATGG + Intronic
1002218589 5:177659644-177659666 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1002673424 5:180889344-180889366 CAGTTTCTTCACAGTGTCGATGG - Intergenic
1002673755 5:180891762-180891784 CAGTTTCTTCACAGTGTTGATGG - Intergenic
1004028206 6:11839261-11839283 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1004266554 6:14153108-14153130 CAATTTCTCCAAAATTTGGAAGG - Intergenic
1004562190 6:16761291-16761313 CACTTACTGTAAAGTGTAAATGG + Exonic
1004760747 6:18663425-18663447 AAATTTCTGCAAGGTGGAAATGG - Intergenic
1005171594 6:22991864-22991886 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1007483146 6:42163137-42163159 AGGCTTCTGCAAAGTGTAGAAGG - Exonic
1007849510 6:44789928-44789950 CAAGTGCTGCAAAGTCTGGAAGG - Intergenic
1008782527 6:55125191-55125213 CAGTTTCTTCATAGTGTTGATGG + Intronic
1008785320 6:55160399-55160421 CAGTTTCTTCATAGTGTTGATGG - Intronic
1009054527 6:58318477-58318499 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1009193877 6:60662029-60662051 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1009236615 6:61132097-61132119 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1009458973 6:63889684-63889706 CAGTTTCTTCATAGTGTTGATGG - Intronic
1009512521 6:64570355-64570377 CAGTTTCTTCATAGTGTCGATGG - Intronic
1009776086 6:68207684-68207706 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1009776866 6:68216696-68216718 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1010038929 6:71359399-71359421 CAGTTTCTTCACAGTGTCGATGG + Intergenic
1010445625 6:75945660-75945682 CAATTTCTGCAAATGGAAAATGG - Intronic
1010575132 6:77520488-77520510 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1011201490 6:84841727-84841749 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1011227858 6:85127402-85127424 CAATTACAGCAAGGTGGAGAGGG + Intergenic
1011333897 6:86238719-86238741 CAATTTCATCATAGTGTTGATGG - Intergenic
1011578429 6:88829438-88829460 CAGTTTCTTCATAGTGTCGATGG - Intronic
1011776576 6:90737820-90737842 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1012644214 6:101659549-101659571 CACTTTCTTCATAGTGTCGATGG + Intronic
1013382528 6:109590152-109590174 CAAATTCTGCTAAATGTTGAAGG - Intronic
1013625436 6:111933051-111933073 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1013672810 6:112423426-112423448 CAATTTCTTCATAGTGTCAATGG - Intergenic
1014058286 6:117042162-117042184 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1014113587 6:117647638-117647660 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1014317889 6:119890262-119890284 AAATTTCTGCAAAGTGTTCAGGG + Intergenic
1014386860 6:120814264-120814286 CAATTTCTTCATAGTGTCGATGG + Intergenic
1014412488 6:121143900-121143922 CATTTTCTGCTAAGAGTATATGG + Intronic
1014701492 6:124694369-124694391 CAATTTATGCAAAGTTGAAAGGG - Intronic
1014967968 6:127780474-127780496 CAGTTTCTTCATAGTGTTGATGG + Intronic
1015241740 6:131031926-131031948 CACTTACTCCAAAGTGAAGAGGG + Intronic
1015444969 6:133293149-133293171 AAATTTCTGCAAAATGAAGTAGG - Intronic
1015472065 6:133616638-133616660 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1015623177 6:135154432-135154454 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1015760321 6:136652503-136652525 CCATTTCTGCAAAGTTTAGATGG - Intronic
1015992811 6:138965011-138965033 CAATTTCTGCATAGTATATGTGG + Intronic
1016647702 6:146428917-146428939 CAAATTCAGTAAAGTATAGAAGG - Intronic
1017322854 6:153112984-153113006 CAGTTTCTTCATAGTGTTGATGG - Intronic
1017642792 6:156510473-156510495 CAATGTTTGCCAAATGTAGAAGG + Intergenic
1017968480 6:159288624-159288646 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1018110238 6:160529901-160529923 CAGTTTCTTCATAGTGTGGATGG - Intergenic
1019071685 6:169351946-169351968 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1020391189 7:7660380-7660402 CAGTTTCTTCATAGTGTTGATGG + Intronic
1020487449 7:8737209-8737231 CAGTTTCTTCATAGTGTTGATGG + Intronic
1020580051 7:9986088-9986110 CAATTTATGCAACTTGAAGATGG + Intergenic
1020630001 7:10627736-10627758 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1020693613 7:11389700-11389722 CAGTTTCTTCATAGTGTTGATGG + Intronic
1020810179 7:12841576-12841598 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1020823592 7:13000792-13000814 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1021502097 7:21343427-21343449 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1021805846 7:24354195-24354217 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1022058618 7:26768535-26768557 CAGTTTCTTCATAGTGTCGATGG + Intronic
1022432723 7:30342306-30342328 CAATTTCTTCATAGTGTTGATGG + Intronic
1022851692 7:34269467-34269489 CAATGTCTGCAAGCTGGAGAAGG + Intergenic
1022885105 7:34634951-34634973 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1023651011 7:42369499-42369521 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1023837331 7:44076041-44076063 CATTTTCTGTAAAATGGAGAAGG - Intronic
1024143432 7:46485345-46485367 CATTTTCTCCAAAGTGCAGTTGG + Intergenic
1024664685 7:51534843-51534865 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1024998304 7:55292999-55293021 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1025788095 7:64661948-64661970 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1026400932 7:70012090-70012112 TACTTTCTGCAAAGCGTTGATGG + Intronic
1026780965 7:73267043-73267065 CAAAGTCTGCAAAGAGTAAACGG + Intergenic
1027021819 7:74820485-74820507 CAAAGTCTGCAAAGAGTAAACGG + Intronic
1027066202 7:75125432-75125454 CAAAGTCTGCAAAGAGTAAACGG - Intronic
1027583091 7:80022184-80022206 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1027637305 7:80691061-80691083 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1027710378 7:81593374-81593396 CCTTTTCTGCCAAGAGTAGAAGG - Intergenic
1027777998 7:82490821-82490843 CAGTTTCTTCATAGTGTTGAAGG + Intergenic
1027843570 7:83343690-83343712 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1028652642 7:93168521-93168543 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1028915666 7:96256138-96256160 CAGTTTCTTCATAGTGTCGATGG - Intronic
1029113030 7:98223165-98223187 CATTTTCTGTACAGTGGAGAGGG + Exonic
1030325626 7:108215989-108216011 CAGTTTCTTCATAGTGTCGATGG + Intronic
1030395428 7:108980629-108980651 CAATTTCTTCATAGTGTCAATGG + Intergenic
1030469551 7:109946574-109946596 CAATTTCAGGAAAGTCTTGAGGG + Intergenic
1030534250 7:110745814-110745836 CAGTTTCTTCATAGTGTCGATGG - Intronic
1031613546 7:123855281-123855303 CATTTTCTTCACAGTGTTGATGG + Intronic
1032538291 7:132682984-132683006 CAATTTCTGCACACTGTGGTAGG + Intronic
1033040877 7:137917075-137917097 CCATTTCAGCAAAGGGCAGATGG - Intronic
1033616227 7:143017044-143017066 TAATTTCTGCAATGTGTACATGG - Intergenic
1033679339 7:143578678-143578700 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1033692498 7:143750766-143750788 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1034314708 7:150119150-150119172 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1034714895 7:153233083-153233105 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1034792192 7:153981621-153981643 CAGTTTCTTCATAGTGTCGATGG + Intronic
1035696297 8:1599950-1599972 CAATTTCTTCATAGTGTCGATGG + Intronic
1035798525 8:2382758-2382780 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1036558211 8:9878651-9878673 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1037022442 8:13990021-13990043 AATTTTCTCCAAAGTGTTGAAGG - Intergenic
1037258065 8:16977918-16977940 CAGTTTCTTCATAGTGTAAATGG + Intergenic
1037545524 8:19916394-19916416 CAGTTTCTTCATAGTGTCGATGG + Intronic
1037664748 8:20958288-20958310 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1039134066 8:34299634-34299656 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1039801989 8:40965897-40965919 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1041051030 8:53934171-53934193 CAGTTTCTTCATAGTGTTGATGG - Intronic
1041836841 8:62225493-62225515 CAGTTTCTTCATAGTGTTGAGGG - Intergenic
1043646995 8:82534145-82534167 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1044595005 8:93951042-93951064 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1046342257 8:112874996-112875018 CAGTTTCTTCATAGTGTCGATGG + Intronic
1048382412 8:133878575-133878597 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1048550702 8:135431235-135431257 CAATTTCTGCTAAGTCTAGGGGG + Intergenic
1049099465 8:140568747-140568769 TCATGTCTGCAAAGTGTAGTGGG + Intronic
1049852333 8:144839515-144839537 CTATTTCTGCCAACTGTAGCTGG - Intronic
1050071785 9:1822731-1822753 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1050075705 9:1861061-1861083 CAATTTCTTCATAGCGTCGATGG - Intergenic
1050129945 9:2401785-2401807 CAATTTCTTCATAGTGTCGACGG + Intergenic
1050390213 9:5134750-5134772 CAGTTTCTTCATAGTGTCGATGG - Intronic
1050942946 9:11483852-11483874 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1051045531 9:12868875-12868897 CAGTTTCTTCAGAGTGTCGATGG + Intergenic
1051230689 9:14951779-14951801 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1051240606 9:15051506-15051528 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1051724385 9:20073738-20073760 GATTTTCTGCAAACTCTAGAAGG - Intergenic
1051863176 9:21649920-21649942 CAGTTTCTTCACAGTGTCGATGG + Intergenic
1052281007 9:26733647-26733669 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1052382117 9:27783285-27783307 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1052464779 9:28816462-28816484 CAATTTAGGCAAATTGTAGGTGG + Intergenic
1052752957 9:32510650-32510672 CAGTTTCTTCATAGTGTCGATGG - Intronic
1054719557 9:68591265-68591287 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1055210518 9:73785064-73785086 CAATTTCTTCATAGTGTCAATGG - Intergenic
1055244193 9:74220391-74220413 AAATCACTGCAAAGTTTAGATGG - Intergenic
1055386616 9:75770017-75770039 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1055390730 9:75819828-75819850 CAATTTCTTCATAGTGTTGATGG + Intergenic
1055634526 9:78262414-78262436 CAATTCCTCCAGAGTGTTGAGGG - Intronic
1056302415 9:85256227-85256249 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1056321126 9:85435473-85435495 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1056384925 9:86088840-86088862 CAGTTTCTTCATAGTGTCGATGG + Intronic
1057419354 9:94898180-94898202 GAATTTCACCAAAGTGTAGGTGG + Intronic
1058029474 9:100179201-100179223 CAGTTTCTTCACAGTGTCGATGG - Intronic
1058081761 9:100708544-100708566 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1058353394 9:104054196-104054218 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1059513574 9:114871742-114871764 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1059817276 9:117931310-117931332 CAATTTCTGGAAAGTACTGATGG - Intergenic
1203517988 Un_GL000213v1:21632-21654 TAATTTCTTCATAGTGTAGATGG + Intergenic
1185913096 X:4004238-4004260 ACATTTCTGCACAGTGTTGATGG + Intergenic
1186038480 X:5449880-5449902 CAATAGCTGCATAGAGTAGATGG + Intergenic
1186375661 X:8996537-8996559 CTATTTCTGCATAGTGAAAAGGG - Intergenic
1186773100 X:12837437-12837459 CAGTTTCTTCATAGTGTCGACGG + Intergenic
1186929349 X:14371237-14371259 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1186963256 X:14760071-14760093 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1187548344 X:20275608-20275630 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1187661069 X:21546991-21547013 CAGTTTCTTCATAGTGTTGATGG - Intronic
1187728837 X:22232875-22232897 CAGTTTCTTCATAGTGTTGATGG + Intronic
1187729755 X:22240300-22240322 CAGTTTCTTCATAGTGTTGATGG - Intronic
1187764622 X:22627237-22627259 AAATTTTTGCAAACTGGAGAAGG + Intergenic
1187784531 X:22868724-22868746 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1189189894 X:39091193-39091215 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1189574890 X:42341449-42341471 CAATTTCTTCATAGTGTCGCTGG + Intergenic
1189590847 X:42509081-42509103 TAATTTCTTCATAGTGTTGATGG - Intergenic
1189595118 X:42556281-42556303 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1189721651 X:43925949-43925971 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1189937981 X:46089182-46089204 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1190506100 X:51127285-51127307 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1191081070 X:56510038-56510060 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1191153462 X:57244792-57244814 CAATTTCTTCATAGTGTCCATGG - Intergenic
1191154213 X:57253836-57253858 CAATTTCTTCATAGTGTTGATGG - Intergenic
1191181737 X:57571194-57571216 CAATTTCTTCATAGTGTTGATGG - Intergenic
1191632154 X:63333103-63333125 CAGTTTCTTCATAGTGTAGATGG - Intergenic
1191635964 X:63377099-63377121 CAGTTTCTGCATAGTGTCAATGG - Intergenic
1191687338 X:63905051-63905073 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1191705314 X:64087678-64087700 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1191711533 X:64154226-64154248 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1191771393 X:64763115-64763137 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1191793994 X:65001506-65001528 CAGTTTCTTCATAGTGTTGATGG - Intronic
1192712422 X:73605571-73605593 CAGTTTCTTCATAGTGTCGATGG + Intronic
1192755621 X:74044654-74044676 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1192966329 X:76181361-76181383 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1192974146 X:76265731-76265753 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1193243218 X:79197335-79197357 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1193245072 X:79218629-79218651 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1193267062 X:79484144-79484166 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1193315793 X:80063697-80063719 CATTTTAAGCAATGTGTAGAGGG - Intergenic
1193355776 X:80519272-80519294 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1193389434 X:80908715-80908737 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1193434166 X:81451318-81451340 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1193510220 X:82390144-82390166 CAGTTTCTTCACAGTGTCGATGG - Intergenic
1193755677 X:85406204-85406226 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1193830214 X:86280516-86280538 CAGTTTCTTCATAGTGTCGATGG - Intronic
1194076811 X:89405077-89405099 CTTTTACTCCAAAGTGTAGAAGG + Intergenic
1194357310 X:92901588-92901610 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1194624982 X:96216575-96216597 CAGTTTCTTCAGAGTGTGGATGG - Intergenic
1195414439 X:104604369-104604391 CAGTTTCTTCATAGTGTTGATGG - Intronic
1195457346 X:105083877-105083899 CAGTTTCTTCATAGTGTCGATGG - Intronic
1195519029 X:105810513-105810535 CAGTTTCTTCATAGTGTCGATGG + Intergenic
1196272949 X:113734076-113734098 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1196312594 X:114185545-114185567 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1196570124 X:117256352-117256374 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1196571494 X:117270432-117270454 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1196602737 X:117621168-117621190 CAGTTTCTTCATAGTGTTGATGG + Intergenic
1197157449 X:123285313-123285335 CAGTTTCTGCATAGTGTCAATGG - Intronic
1197191303 X:123650370-123650392 CAGTTTCTTCATAGTGTCGATGG - Intronic
1197927129 X:131658240-131658262 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1198042539 X:132867847-132867869 CAGTTTCTTCATAGTGTCGATGG - Intronic
1198295181 X:135280566-135280588 CAGTTTCTTCATAGTGTCGATGG + Intronic
1198437165 X:136628516-136628538 CAATTTCAGCTCAGTGTGGATGG + Intergenic
1198490154 X:137131501-137131523 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1198499302 X:137226918-137226940 GAACTGCTGCAAAGTGAAGATGG + Intergenic
1198595747 X:138233710-138233732 CATTTAATGCAATGTGTAGAGGG + Intergenic
1198680540 X:139177500-139177522 CAGTTTCAGCACAGTGTTGATGG + Intronic
1199161709 X:144619585-144619607 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1199308413 X:146294147-146294169 CATTTTCTGCAAAGTTTCCAAGG - Intergenic
1199524695 X:148779825-148779847 CAGTTTCTTCATAGTGTTGATGG + Intronic
1200333444 X:155321627-155321649 CAGTTTCTTCACAGTGTCGATGG - Intronic
1200407830 Y:2831337-2831359 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1200416845 Y:2920976-2920998 CAGTTTCTTCACAGTGTCGATGG + Intronic
1200429455 Y:3060605-3060627 CTTTTACTCCAAAGTGTAGAAGG + Intergenic
1200522637 Y:4230343-4230365 CAGTTTCTTCATAGTGTCGATGG - Intergenic
1201371276 Y:13267592-13267614 CAGTTTCTTCATAGTGTCGATGG + Intronic
1201633009 Y:16090931-16090953 CAATAGCTGCATAGAGTAGATGG - Intergenic
1201672655 Y:16541540-16541562 CAGTTTCTTCATAGTGTTGATGG - Intergenic
1201693094 Y:16790903-16790925 CAGTTTCTTCAAAGTGTCAATGG - Intergenic
1201961739 Y:19688689-19688711 CAGTTTCTTCATAGTGTTGATGG + Intergenic