ID: 1072300895

View in Genome Browser
Species Human (GRCh38)
Location 10:94061042-94061064
Sequence GTACCTGCTTAGTCTCAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 182}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072300895_1072300901 8 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300901 10:94061073-94061095 CTCCCAGGGGTTCAGCGAGGAGG No data
1072300895_1072300906 19 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300906 10:94061084-94061106 TCAGCGAGGAGGAAACTGTGGGG No data
1072300895_1072300897 -6 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300897 10:94061059-94061081 AGGTACTGTACTGCCTCCCAGGG No data
1072300895_1072300908 25 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300908 10:94061090-94061112 AGGAGGAAACTGTGGGGCAAGGG No data
1072300895_1072300898 -5 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300898 10:94061060-94061082 GGTACTGTACTGCCTCCCAGGGG No data
1072300895_1072300905 18 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300905 10:94061083-94061105 TTCAGCGAGGAGGAAACTGTGGG No data
1072300895_1072300907 24 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300907 10:94061089-94061111 GAGGAGGAAACTGTGGGGCAAGG No data
1072300895_1072300904 17 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300904 10:94061082-94061104 GTTCAGCGAGGAGGAAACTGTGG No data
1072300895_1072300899 5 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300899 10:94061070-94061092 TGCCTCCCAGGGGTTCAGCGAGG No data
1072300895_1072300896 -7 Left 1072300895 10:94061042-94061064 CCGTACTGAGACTAAGCAGGTAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1072300896 10:94061058-94061080 CAGGTACTGTACTGCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072300895 Original CRISPR GTACCTGCTTAGTCTCAGTA CGG (reversed) Intronic
910330666 1:86069127-86069149 GTACCAGCTTGGCCACAGTAGGG + Intronic
912871532 1:113311291-113311313 GTACCAGCTTGGTCACAGTGGGG + Intergenic
912899264 1:113630447-113630469 GTACCAGCTCAGCCACAGTAGGG - Intronic
914683516 1:149958050-149958072 GTACCGGGTTCATCTCAGTAGGG - Intronic
914718561 1:150270694-150270716 CTACCCTCTTAGTCTCATTAGGG - Intronic
915761759 1:158320565-158320587 GTACCGGGTTCGTCTCACTAGGG - Intergenic
916360579 1:163962925-163962947 GTACCAGCTTAGTCACAGTGAGG + Intergenic
920508012 1:206530738-206530760 GTACTTGCTTAGAGTCTGTAAGG - Intronic
921002280 1:211056073-211056095 GTACCAGCTCAGTCACAGTAGGG + Intronic
922172521 1:223167751-223167773 GTACCGGGTTCATCTCAGTAGGG + Intergenic
924912391 1:248528047-248528069 GTACCGGGTTCGTCTCACTAGGG + Intergenic
1068085272 10:52366219-52366241 GTACCAGCTTCGCCTCATTAGGG - Intergenic
1069457993 10:68568979-68569001 GTACCTGCTATGTCTAAGGAAGG - Intronic
1071352705 10:84762765-84762787 GTACCGGGTTCGTCTCACTAGGG - Intergenic
1071799429 10:89042548-89042570 GTACCAGCTTAGCCACAGTGGGG - Intergenic
1072300895 10:94061042-94061064 GTACCTGCTTAGTCTCAGTACGG - Intronic
1074282117 10:112062489-112062511 GTACCGGGTTCGTCTCATTAGGG + Intergenic
1074789021 10:116867637-116867659 GTAACAGCTTATTCTTAGTAAGG + Intronic
1074828147 10:117229306-117229328 CTACCTGCTTTGTCTCAGCCAGG + Intergenic
1075890446 10:125945336-125945358 GTACCGGGTTTGTCTCACTAGGG + Intronic
1079301898 11:19285893-19285915 GTAGCTGCTTATTATTAGTATGG + Intergenic
1081941074 11:46942523-46942545 GAACCTGCTTATTCTCACTACGG + Intronic
1082629226 11:55521109-55521131 GTACCTGGTTCATCTCACTAGGG - Intergenic
1082945064 11:58749731-58749753 GTACCTGGTTCATCTCATTAGGG + Intergenic
1085562790 11:77487457-77487479 GTACCAGCTCAGCCACAGTAGGG + Intergenic
1085861332 11:80239547-80239569 GTACTTTCTTGGTCTCAGGATGG - Intergenic
1085980529 11:81718688-81718710 GTACCAGCTCGGTCACAGTAGGG + Intergenic
1086867144 11:91993327-91993349 TTACTAGCTTATTCTCAGTAAGG + Intergenic
1087519536 11:99213871-99213893 GTACTTGTTTATTCTCAGCATGG - Intronic
1087691037 11:101320774-101320796 GTACAAGCTTGGTCACAGTAGGG - Intergenic
1088154848 11:106790481-106790503 GTACCAGCTCAGCCCCAGTAAGG - Intronic
1088938263 11:114426288-114426310 ATACCAGCTTAGTCACAGTATGG - Intronic
1091051236 11:132374422-132374444 GTACTAGCTTAGTCACGGTAGGG + Intergenic
1092939826 12:13397515-13397537 GTACCGGGTTCGTCTCACTAGGG - Intergenic
1094720935 12:33063310-33063332 GTAACTGTTTAGTCTCCGAAAGG - Intergenic
1095064995 12:37761798-37761820 GTACCGGGTTCATCTCAGTAGGG + Intergenic
1098706552 12:73698554-73698576 TTACCTGTTTAGAATCAGTATGG + Intergenic
1099773716 12:87098500-87098522 GTACCGGGTTCGTCTCACTAGGG + Intergenic
1099779085 12:87171499-87171521 GTACCTGGTTCGTCTCACTGGGG + Intergenic
1101054053 12:100894328-100894350 GTTGTTGCTTAGTCTCAGTAGGG - Intronic
1101537076 12:105628360-105628382 GTACCGGGTTCATCTCAGTAGGG + Intergenic
1101629331 12:106477770-106477792 GTACCGGGTTCATCTCAGTAGGG - Intronic
1102843097 12:116147010-116147032 GTACCTTCTTAGGCATAGTAGGG - Intronic
1103892412 12:124249838-124249860 GAAACTGCTTCGTCTCATTAGGG + Intronic
1107010790 13:35668810-35668832 GTTCCTGCCTAGTCTCAGACAGG + Intronic
1108098980 13:46935055-46935077 GTACCAGCTCAGACACAGTAGGG + Intergenic
1109062882 13:57641334-57641356 GCTTCTGCTTAGTCACAGTAGGG - Intronic
1109884083 13:68519956-68519978 CTACCTTCTTAGACTCACTATGG - Intergenic
1111076897 13:83248790-83248812 GTACCAGCTCAGTCACAGTGCGG - Intergenic
1112835456 13:103508534-103508556 GTACCAGGTTCGTCTCACTAGGG - Intergenic
1112846313 13:103647604-103647626 GTAGCTGCTTAGGCTTAGAAAGG + Intergenic
1114247516 14:20928416-20928438 GCACCTGTGTAGTCTCAGGAGGG - Intergenic
1115660951 14:35494061-35494083 ATACCAGCTCAGTCCCAGTAGGG + Intergenic
1115918350 14:38342822-38342844 GTACCAGCTCAGCCACAGTAAGG + Intergenic
1118246152 14:64113125-64113147 GTACCTGCTTACTCGCAGATCGG + Intronic
1119496227 14:75081797-75081819 CTACCTCCTCAGTCTCAGTGGGG - Exonic
1121760950 14:96444534-96444556 GTAACAGCTTAGTTTCAGTTTGG - Intronic
1122740884 14:103871086-103871108 GTGCCTTGTTAGTCTCAGGATGG + Intergenic
1125853658 15:42928268-42928290 GTCCCTGCTTATTCTTAGCACGG + Intergenic
1126167184 15:45663473-45663495 GTACCTGCTTTGGCTGAGCATGG + Intronic
1126254869 15:46614400-46614422 GTACCGGGTTCATCTCAGTAGGG + Intergenic
1127034064 15:54895570-54895592 GTACCAGCTTGGTCACAGTGAGG - Intergenic
1127132614 15:55883044-55883066 GTACCAGCTTGGCCACAGTAGGG + Intronic
1136992177 16:35160251-35160273 GTACCTGGTTCATCTCACTAGGG + Intergenic
1143680353 17:8471602-8471624 TGGGCTGCTTAGTCTCAGTAGGG + Intronic
1155530253 18:26759338-26759360 GAACCTGCTTATCCTTAGTAAGG - Intergenic
1156116847 18:33795953-33795975 GAACCTGCTTAGCCACATTATGG - Intergenic
1157166883 18:45365949-45365971 GTACGTGCTTAGTCTGTTTATGG - Intronic
1157923714 18:51740728-51740750 GTACCCGGTTCATCTCAGTAGGG + Intergenic
1158732148 18:60035588-60035610 GTACCGGGTTAATCTCACTAGGG - Intergenic
1158748796 18:60234319-60234341 TTTCCTGCTTAGTGTCAGTTTGG + Intergenic
1159311377 18:66715172-66715194 GTACCTGGTTCATCTCACTAGGG + Intergenic
1164584615 19:29459388-29459410 GTACCTGGTTCATCTCACTAGGG + Intergenic
1164832381 19:31332586-31332608 ATCCCTACTTAGTCTCAGTTTGG + Intronic
926426223 2:12740802-12740824 GAACCTGCTAAGTCTCCGTGGGG - Exonic
926632784 2:15152249-15152271 GGACTTGGTTAGTCTCAGTATGG - Intergenic
928127816 2:28628389-28628411 GTTGCTGCTGAGTCTCTGTAAGG - Intronic
928863958 2:35895502-35895524 GTACCAGCTTGGTCACAGTGGGG - Intergenic
929497698 2:42460716-42460738 GTACCTGTTTAATCTATGTAGGG - Intronic
930800939 2:55442203-55442225 GTACCGGGTTCGTCTCACTAGGG + Intergenic
930878297 2:56244557-56244579 GTACCAGCTTATCCACAGTAGGG - Intronic
931012167 2:57929548-57929570 GTACCAGCTCAGCCACAGTAGGG - Intronic
931840677 2:66144831-66144853 GTACCGGGTTTGTCTCACTAGGG - Intergenic
931846165 2:66206416-66206438 GTACCGGGTTCGTCTCACTAGGG + Intergenic
932935460 2:76096666-76096688 GTACCTGGTTCATCTCATTAGGG - Intergenic
934764555 2:96873436-96873458 GTACCTGACTAGTCTCCCTAGGG + Intergenic
936901324 2:117484968-117484990 GTACCTGCTCAGCCACAGTGGGG - Intergenic
936925351 2:117731098-117731120 GTACCAGCTTGGTCACAGTGGGG + Intergenic
938148989 2:128864896-128864918 GTACCGGGTTCATCTCAGTAGGG - Intergenic
938220830 2:129565911-129565933 GCACCTGCTGATTCACAGTATGG - Intergenic
938796831 2:134724650-134724672 ATAGCTGCTTAGGCTCAGAAAGG - Intergenic
940407126 2:153317641-153317663 GTAACTGCCTGGTATCAGTATGG - Intergenic
941534773 2:166708637-166708659 GTACTGGGTTAGTCTCACTAGGG - Intergenic
942991904 2:182212501-182212523 GTACCGGGTTCATCTCAGTAGGG + Intronic
943255819 2:185591789-185591811 GTACCGGCTTCATCTCACTAGGG - Intergenic
1174734459 20:52952428-52952450 TTACCTTCTTAGTCTCAACATGG + Intergenic
1177762582 21:25418944-25418966 GTCACTGATTAGTCTCAGAAAGG + Intergenic
1184157712 22:42679266-42679288 GTACCTGCATTGTGTCAGGAAGG + Intergenic
950228914 3:11259144-11259166 CTATCTGCTTGGTCACAGTAGGG + Exonic
951442962 3:22743637-22743659 GTACCGGCTTCATCTCACTAGGG - Intergenic
952028501 3:29111994-29112016 GTACCTGGTTTATCTCACTAGGG - Intergenic
956266516 3:67402676-67402698 GGACCTGCTGAGGCTCAGTAAGG + Intronic
957018873 3:75101384-75101406 GTACCAGCTTGGTCACAGTGAGG - Intergenic
958086401 3:88813686-88813708 GTATCTGGTTAGTATGAGTAAGG - Intergenic
959409059 3:105997733-105997755 GTACCAGCTTGGCCTCAGTGGGG - Intergenic
959955282 3:112230633-112230655 CTACCTGCTCAGTCTAACTAGGG - Intronic
960404149 3:117238851-117238873 ATACCTGCTTGGCCACAGTAAGG + Intergenic
962442983 3:135439740-135439762 GTACCAGGTTCGTCTCACTAGGG - Intergenic
962483330 3:135816631-135816653 GTACCAGCTCAGCCACAGTAGGG + Intergenic
963101175 3:141605919-141605941 GTAGCTGCTAACTCTCAGAAGGG - Intronic
965260494 3:166477993-166478015 GTACCAGCTTAGCCACAGTGAGG + Intergenic
966141951 3:176767118-176767140 GTACCAGCTCAGCCACAGTAGGG + Intergenic
966274227 3:178145492-178145514 GTACTTGCATAGTTTCAGAAAGG - Intergenic
966361355 3:179132746-179132768 GTACCGGGTTCGTCTCACTAGGG - Intergenic
969190837 4:5518278-5518300 GTACCGGCTTCATCTCACTAGGG + Intergenic
970896506 4:21109634-21109656 GTACCAGGTTCGTCTCACTAGGG - Intronic
974301025 4:60067413-60067435 GTACCAGCTTGGACACAGTAGGG + Intergenic
974530226 4:63098334-63098356 GTACCGGCTTCATCTCACTAGGG - Intergenic
974593250 4:63983329-63983351 GTACCTGCTCAGCCACAGTTTGG - Intergenic
975283756 4:72593810-72593832 GTACCGGCTTATTCACACTAGGG + Intergenic
977480324 4:97566469-97566491 GTACCGGGTTCGTCTCACTAGGG - Intronic
979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG + Intergenic
979376705 4:119954638-119954660 GTACCGGCTTCATCTCACTAGGG - Intergenic
981162078 4:141509940-141509962 GTACCAGGTTAATCTCACTAAGG - Intergenic
981260227 4:142709777-142709799 TTACCTGCTTTGTCTCAGAGGGG + Intronic
982053267 4:151524788-151524810 ACACCTGCTGAGTATCAGTATGG + Intronic
983716648 4:170788894-170788916 GTACCGGCTTCATCTCACTAGGG - Intergenic
990774212 5:59287068-59287090 GTACCAGCTTAGCCACAGCAGGG + Intronic
991304647 5:65164116-65164138 GTACCGGGTTAATCTCACTAGGG + Intronic
991421849 5:66450309-66450331 GTACCGGCTTCATCTCACTAGGG - Intergenic
991682121 5:69150050-69150072 GTACCAGCTTAGCCACAGTGGGG - Intergenic
992291382 5:75283429-75283451 GTACCAGCTTGGTCACAGTGAGG + Intergenic
992514205 5:77474901-77474923 GTACCGGGTTCGTCTCACTAGGG + Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
992934539 5:81688012-81688034 GTACCAGCTTGGCCACAGTAGGG + Intronic
995343985 5:111090789-111090811 GTACCGGGTTCATCTCAGTAGGG - Intergenic
996212671 5:120831523-120831545 GTACCGGGTTCATCTCAGTAGGG + Intergenic
1000208487 5:159086372-159086394 GTAACTGGTGAATCTCAGTAGGG - Intronic
1004173024 6:13313588-13313610 GGGCATGCTTACTCTCAGTATGG + Intronic
1005801957 6:29435122-29435144 GTACCTGCTTTTTCTAAGCAAGG - Intronic
1007001641 6:38319250-38319272 GTACCAGCTTAGCCACAGTGAGG - Intronic
1008126464 6:47674561-47674583 GTACCTGTTTAGTATTAGTGGGG - Intronic
1008731778 6:54491508-54491530 GTACCAGCTTTGTCACAGTGAGG - Intergenic
1009239229 6:61163634-61163656 GTACCGGGTTCATCTCAGTAGGG - Intergenic
1009893795 6:69721712-69721734 GTACCAGCTCAGCCACAGTAAGG + Intronic
1011333223 6:86233549-86233571 GTACCAGCTTAGCCACAGTAGGG - Intergenic
1011359728 6:86510807-86510829 GTACCAGCTTAGTCACAGGTTGG - Intergenic
1011387373 6:86812564-86812586 GTACCGGGTTCATCTCAGTAGGG - Intergenic
1012474704 6:99606326-99606348 GTACCTGCCTAATTTCTGTATGG + Intergenic
1016228482 6:141771973-141771995 GTACCAGCTCAGCCACAGTAGGG - Intergenic
1018111401 6:160540039-160540061 GTACCTGCTTAGCTTTAGCAAGG + Exonic
1018131842 6:160739190-160739212 GTACCTGCTTAGCTTTAGCAAGG - Exonic
1018506061 6:164470879-164470901 GGACTTGTTTAGTCTCAGTATGG + Intergenic
1022775964 7:33527654-33527676 GTACCTGGTTCATCTCACTAGGG - Intronic
1023716258 7:43047119-43047141 GTACCAGTTTGGTCACAGTAAGG + Intergenic
1024005645 7:45223557-45223579 GTACCTCATTAGTCTCAAGATGG - Intergenic
1027292379 7:76728582-76728604 GTACCAGGTTCATCTCAGTAGGG + Intergenic
1029825290 7:103186764-103186786 GTACCAGCTTGGCCTCAGTGGGG + Intergenic
1030431598 7:109455539-109455561 GTACCAGCTTGGTCACAGTGAGG - Intergenic
1030629457 7:111879476-111879498 GTACCAGCTCAGTCACAGTGGGG + Intronic
1035550801 8:523453-523475 GTACCAGCTCAGCCACAGTAGGG + Intronic
1041579907 8:59446863-59446885 GTACCAGCTTGGCCACAGTAAGG - Intergenic
1042082537 8:65071061-65071083 GTACCAGCTTGGCCACAGTAGGG - Intergenic
1042504369 8:69543853-69543875 CTACCTGCTCAGCCTCAGGATGG + Intronic
1043042304 8:75278465-75278487 GTACCGGCTTCATCTCACTAGGG + Intergenic
1043594785 8:81872402-81872424 GAACTTGTTTGGTCTCAGTATGG + Intergenic
1046387731 8:113525194-113525216 GTACCGGGTTAATCTCACTAGGG - Intergenic
1048646673 8:136428444-136428466 ATACCAGCTTAGCCACAGTAGGG + Intergenic
1050807146 9:9694951-9694973 GTACCAGCTTGGCCACAGTAGGG - Intronic
1052995672 9:34550598-34550620 ATGCCTGCTTATGCTCAGTAAGG + Intergenic
1058134351 9:101290893-101290915 GTACCTGGTTCATCTCACTAGGG + Intronic
1058249064 9:102668880-102668902 GTACCAGCTTGGTCACAGTGGGG - Intergenic
1188206550 X:27366350-27366372 TCACCTCCTTAGTCTTAGTAGGG - Intergenic
1190122338 X:47672428-47672450 GTACCAGCTTAGCCACAGTGGGG - Intergenic
1190634496 X:52420545-52420567 CTACCAGCTGAGTCTCAGTAGGG - Intergenic
1190648311 X:52543945-52543967 TTACCGGCTGCGTCTCAGTAGGG - Intergenic
1191032709 X:55991531-55991553 GTACCGGCTTCATCTCACTAGGG - Intergenic
1192380810 X:70614198-70614220 GTACCAGCTCAGCCACAGTAGGG + Intronic
1193765937 X:85529305-85529327 GTACCGGCTTCATCTCACTAGGG + Intergenic
1193817295 X:86119228-86119250 GTACCGGCTTCATCTCACTAGGG - Intergenic
1193986807 X:88252616-88252638 GTACCAGCTCAGCCACAGTAAGG - Intergenic
1194937618 X:99970335-99970357 GTACCAGCTTGGCCACAGTAAGG - Intergenic
1195517766 X:105797005-105797027 GTACCGGGTTCGTCTCACTAGGG + Intergenic
1196182127 X:112703840-112703862 GTACCAGCTTGGTCACAGTGAGG - Intergenic
1196511826 X:116520509-116520531 GTACCTGGTTCATCTCACTAGGG - Intergenic
1197199937 X:123739884-123739906 ATACCTGCTTATTCTCAGCCAGG - Intergenic
1197487785 X:127075000-127075022 GTACCAGCTCAGCCTCAGTCAGG - Intergenic
1197600373 X:128520417-128520439 GTACCAGCTTGGCCTCAGAATGG + Intergenic
1199379217 X:147148047-147148069 GTACCGGCTTCATCTCACTAGGG - Intergenic
1200820319 Y:7575953-7575975 GTACCTGGTTCATCTCACTAGGG - Intergenic
1201230659 Y:11860974-11860996 GTACCTGGTTCATCTCACTAGGG - Intergenic
1202298416 Y:23384476-23384498 GTACCGGGTTCGTCTCACTAGGG - Intergenic
1202572392 Y:26286123-26286145 GTACCGGGTTCGTCTCACTAGGG + Intergenic