ID: 1072304113

View in Genome Browser
Species Human (GRCh38)
Location 10:94090486-94090508
Sequence CTTTCCACACAACTTTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072304113_1072304127 26 Left 1072304113 10:94090486-94090508 CCTGTCCAAAGTTGTGTGGAAAG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1072304127 10:94090535-94090557 ATGGAAGGTGCGGGGTGTCTTGG No data
1072304113_1072304125 18 Left 1072304113 10:94090486-94090508 CCTGTCCAAAGTTGTGTGGAAAG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG No data
1072304113_1072304120 7 Left 1072304113 10:94090486-94090508 CCTGTCCAAAGTTGTGTGGAAAG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1072304120 10:94090516-94090538 TTGGCATCTCTCCTTCCTTATGG No data
1072304113_1072304123 17 Left 1072304113 10:94090486-94090508 CCTGTCCAAAGTTGTGTGGAAAG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1072304123 10:94090526-94090548 TCCTTCCTTATGGAAGGTGCGGG No data
1072304113_1072304122 16 Left 1072304113 10:94090486-94090508 CCTGTCCAAAGTTGTGTGGAAAG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1072304122 10:94090525-94090547 CTCCTTCCTTATGGAAGGTGCGG No data
1072304113_1072304121 11 Left 1072304113 10:94090486-94090508 CCTGTCCAAAGTTGTGTGGAAAG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1072304121 10:94090520-94090542 CATCTCTCCTTCCTTATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072304113 Original CRISPR CTTTCCACACAACTTTGGAC AGG (reversed) Intronic
901580963 1:10243036-10243058 CTTTCCACACCACATTGTTCCGG + Intronic
903775376 1:25790033-25790055 CTGTCTACAAAACTTTGGAAGGG + Intergenic
907084410 1:51656664-51656686 CTCTCCCCCCAACTTTTGACAGG + Intronic
908438087 1:64126619-64126641 ATTTCCATACAACCTTGGATAGG - Intronic
909736555 1:78969589-78969611 ATTTCCTCACACCTTTGGATTGG - Intronic
909937786 1:81573676-81573698 CTTTCAAAACCACTTTGTACGGG - Intronic
912889316 1:113511667-113511689 CTTTCTAGACAACCTTGAACAGG + Intronic
915734299 1:158075064-158075086 CTTTCCCCACAACTTGGCAAAGG + Intronic
919001238 1:191833716-191833738 CTTTCCATACTACTTTTGAAAGG - Intergenic
1067012187 10:42724673-42724695 TTTTACACACACCTTTGTACTGG + Intergenic
1070053728 10:72914179-72914201 CTCTCCACACACCTCTGCACAGG - Intronic
1070314340 10:75295918-75295940 CTTTGGACACAAGTTTGGAGGGG - Intergenic
1072304113 10:94090486-94090508 CTTTCCACACAACTTTGGACAGG - Intronic
1076170310 10:128313675-128313697 CTTTCTGCACAACTTGGGGCTGG - Intergenic
1078898525 11:15619928-15619950 TTTTCCACACAACTCTGAGCAGG - Intergenic
1085857873 11:80196388-80196410 CTCTCCAAACATCTTTGGTCAGG - Intergenic
1090838376 11:130469680-130469702 CTTTCCACTCACCTTTGGCAAGG + Intronic
1090965877 11:131597383-131597405 CTTTCCCCACCACTTTGGCGGGG + Intronic
1100797097 12:98193870-98193892 CTTTGCACACAATTTTTGTCTGG - Intergenic
1100876610 12:98968585-98968607 ACTTCCATACAACTTTGGAGAGG + Intronic
1103272759 12:119687387-119687409 CTTTCCATATAGCTTTGGCCAGG - Exonic
1106206244 13:27598161-27598183 CTTACCACACCACTTAGGAGTGG + Intronic
1109718289 13:66245617-66245639 ATTTCCACAGATCTTAGGACAGG - Intergenic
1115433965 14:33352473-33352495 CTTGCCACAACTCTTTGGACTGG + Intronic
1115513629 14:34163033-34163055 CTTTCCCTACCACTTTTGACAGG - Intronic
1119274679 14:73343544-73343566 CTTTCCTCACAACTATGGCTTGG + Intronic
1121517556 14:94562818-94562840 CTATCCCCACAACTTTGGGCAGG + Intronic
1122326315 14:100882727-100882749 CTTTCCACACATCTTCGGTGCGG + Exonic
1122931592 14:104935342-104935364 CTTTCCACACACCTGGGGACTGG + Exonic
1128406276 15:67342893-67342915 CTGTCCTCAGAAGTTTGGACAGG + Intronic
1129199627 15:73991323-73991345 CTTTCCTCCCAACCCTGGACAGG + Intronic
1129697328 15:77748057-77748079 CCTTCCACACAACTCTAAACAGG + Intronic
1136411024 16:30077111-30077133 CTTCCCACAGAACTCTGAACTGG - Intronic
1143329467 17:6122541-6122563 GTTTCCACACTGCTGTGGACGGG + Exonic
1154074311 18:11184412-11184434 CTTACAAAACCACTTTGGACTGG + Intergenic
1158647789 18:59263388-59263410 TTTTGCAGACAACTTTGGACAGG + Intergenic
1161900070 19:7111821-7111843 CTGTCCACCCAACCTGGGACAGG + Intergenic
1164712245 19:30365469-30365491 CTTCCCACACAGCTTTGGTGGGG + Intronic
1166047609 19:40238643-40238665 CTCTCCACACCTCTCTGGACTGG + Intronic
1166915129 19:46190284-46190306 ATTTCCAGACAACTGAGGACAGG - Intergenic
1168139712 19:54377214-54377236 TTTTCCCAACAACTTTGGAAAGG + Intergenic
925528641 2:4834456-4834478 CTTTCCAAACAATTTGGGTCAGG + Intergenic
927496030 2:23552564-23552586 CTTCCCTCAAAGCTTTGGACTGG + Intronic
930166589 2:48209435-48209457 CTTTCCAGAGAACCTTGGGCTGG + Intergenic
937281954 2:120723535-120723557 CTGTCCCCACACCTTTGAACTGG - Intergenic
939697866 2:145350139-145350161 CTCTCCAAAGAGCTTTGGACTGG - Intergenic
941264926 2:163348950-163348972 TTTGCCACACAAATTTGAACTGG + Intergenic
941367600 2:164626142-164626164 CTATCCTCACAACTTTGCAGTGG + Intergenic
944120439 2:196234869-196234891 CCTTCCCCACAACTTTGCAAAGG + Intronic
945333730 2:208567813-208567835 CTAGCCACAAAACTTTGCACAGG + Intronic
1169819434 20:9692418-9692440 TTATCCACAGAACTTTGGAAGGG + Intronic
1176703492 21:10089304-10089326 GTTTCCACTGAACTTTGGACTGG - Intergenic
1178604595 21:34024886-34024908 GTTTCCACACAGCTTGGGACAGG + Intergenic
1180124678 21:45781654-45781676 ATTTCCATACACCTTTGAACAGG + Intronic
952362347 3:32643424-32643446 CTTGCAACACAACCTTGCACTGG - Intergenic
952991928 3:38837684-38837706 CTTTCCACCCAGCGTTGGAGAGG - Intergenic
959441320 3:106378795-106378817 TTTTCCCCACTACTTTGGGCAGG - Intergenic
960362079 3:116725098-116725120 CTTTCCACACATGATAGGACGGG - Intronic
961397496 3:126606177-126606199 CTTCCCACTCAACTTTGCACTGG + Intronic
962343756 3:134605349-134605371 CTTTGCACTCAACTGTGAACGGG - Intronic
965521942 3:169676964-169676986 CTTTGCACAGAACTTGGTACAGG + Intergenic
965969371 3:174534759-174534781 CTTTCCAAGCAACTCTGGAGAGG - Intronic
970859741 4:20688097-20688119 CTTTCCACACAGCGTTGGCTAGG - Intergenic
972449941 4:39186979-39187001 CTTTCCACATAACTTTGTAAAGG + Intronic
975010185 4:69341130-69341152 CTTCCAACACAACATTGAACAGG - Intronic
980375709 4:131945660-131945682 GTTTCCACTGAACTTTGGACTGG - Intergenic
992851435 5:80813612-80813634 CTTTCCACCCATGTTTGGTCCGG - Exonic
993755733 5:91727458-91727480 CGTTTCACTCAACTTTAGACAGG + Intergenic
994936718 5:106262536-106262558 CTTTCCCCACCACCTGGGACTGG - Intergenic
996196782 5:120617024-120617046 CTTTCCAAAAAACACTGGACTGG - Intronic
996341814 5:122446797-122446819 CTTCCCCCAGAATTTTGGACTGG - Intronic
996354750 5:122583159-122583181 CTTTCCCCAGAACTATGAACTGG - Intergenic
998180985 5:139941805-139941827 CGTTCCACACAAGTTTGCAATGG - Intronic
1000250498 5:159490141-159490163 CTTCCTGCAAAACTTTGGACAGG - Intergenic
1002759205 6:188889-188911 CTTTCCCCACAGCTCTGGGCTGG + Intergenic
1008699645 6:54083386-54083408 CTTCCCCAACAACTCTGGACTGG - Intronic
1009432921 6:63586476-63586498 CTTTCCCCACTACTTTTGCCAGG - Intergenic
1015602543 6:134924400-134924422 CTGTCCACTCAACCTTGGACTGG + Intronic
1016468991 6:144355119-144355141 CTTTCCACACATTTTTTAACAGG - Intronic
1019743289 7:2686026-2686048 GTTTCCACAGATCTTTGTACAGG - Intronic
1023331496 7:39122441-39122463 CTTTACACACTACTTGGCACCGG - Intronic
1030043224 7:105470749-105470771 CCTTCCACACACCTTTTGACAGG + Exonic
1033235392 7:139634138-139634160 CTTTCCTCACAACTAGAGACTGG + Intronic
1040757595 8:50798109-50798131 CTATCCACACAAAAGTGGACTGG - Intergenic
1040996649 8:53409071-53409093 CTTTCCACACAGTTTTCAACAGG - Intergenic
1041059950 8:54025642-54025664 GTTCCCACAAAACTTTGTACAGG - Intergenic
1042464102 8:69106949-69106971 CTTTGCACACAAGTGTTGACTGG - Intergenic
1042544032 8:69934871-69934893 CTTTCCTCATAAATATGGACAGG + Intergenic
1047291878 8:123538867-123538889 CTTACCACAAAAGTTTAGACTGG - Intronic
1049472453 8:142782555-142782577 TTTTCCACTCCACTCTGGACAGG - Intergenic
1051769509 9:20561559-20561581 CTTTAAAGACAACTTTGGAAAGG - Intronic
1053640752 9:40076325-40076347 GTTTCCACTGAACTTTGGACTGG - Intergenic
1053765383 9:41389147-41389169 GTTTCCACTGAACTTTGGACTGG + Intergenic
1054321440 9:63672308-63672330 GTTTCCACTGAACTTTGGACTGG - Intergenic
1054544000 9:66300307-66300329 GTTTCCACTGAACTTTGGACTGG + Intergenic
1202788527 9_KI270719v1_random:59399-59421 GTTTCCACTGAACTTTGGACTGG - Intergenic
1188286537 X:28332663-28332685 GTTTCCATTCAACTTTGTACTGG - Intergenic
1189748800 X:44197511-44197533 CTTCCCACACCATTTTGGAGGGG - Intronic
1200118217 X:153778496-153778518 CTTTCCACCCACGTGTGGACAGG - Intronic