ID: 1072304118

View in Genome Browser
Species Human (GRCh38)
Location 10:94090491-94090513
Sequence GCCCCCTTTCCACACAACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 95}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072304118_1072304121 6 Left 1072304118 10:94090491-94090513 CCAAAGTTGTGTGGAAAGGGGGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1072304121 10:94090520-94090542 CATCTCTCCTTCCTTATGGAAGG No data
1072304118_1072304123 12 Left 1072304118 10:94090491-94090513 CCAAAGTTGTGTGGAAAGGGGGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1072304123 10:94090526-94090548 TCCTTCCTTATGGAAGGTGCGGG No data
1072304118_1072304122 11 Left 1072304118 10:94090491-94090513 CCAAAGTTGTGTGGAAAGGGGGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1072304122 10:94090525-94090547 CTCCTTCCTTATGGAAGGTGCGG No data
1072304118_1072304125 13 Left 1072304118 10:94090491-94090513 CCAAAGTTGTGTGGAAAGGGGGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG No data
1072304118_1072304120 2 Left 1072304118 10:94090491-94090513 CCAAAGTTGTGTGGAAAGGGGGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1072304120 10:94090516-94090538 TTGGCATCTCTCCTTCCTTATGG No data
1072304118_1072304127 21 Left 1072304118 10:94090491-94090513 CCAAAGTTGTGTGGAAAGGGGGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1072304127 10:94090535-94090557 ATGGAAGGTGCGGGGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072304118 Original CRISPR GCCCCCTTTCCACACAACTT TGG (reversed) Intronic
903679076 1:25085003-25085025 GCCCCCATCCCACCCAACTCTGG + Intergenic
908823164 1:68108523-68108545 GCCCCCTTCCCACTCCACTGTGG + Intronic
918912953 1:190596927-190596949 GCTCTCTAGCCACACAACTTGGG - Intergenic
920133772 1:203753350-203753372 GCCCCCTTTCTGCACAGCTCTGG + Intergenic
920946857 1:210537439-210537461 CCCCCCTTTCCACACCAATGTGG + Intronic
924546218 1:245030227-245030249 GCCCCGTTTCCAAACAAGTGTGG - Intronic
924772337 1:247088739-247088761 TGCCCCTTTCCCCACACCTTGGG - Intergenic
1069597375 10:69681172-69681194 GCCCCACCTCCTCACAACTTGGG + Intergenic
1072304118 10:94090491-94090513 GCCCCCTTTCCACACAACTTTGG - Intronic
1074130410 10:110568232-110568254 GCCACCTTTCCACACATCCCAGG - Intronic
1076746420 10:132517064-132517086 GCCCTCTTTCCAACCAGCTTGGG - Intergenic
1076986195 11:237246-237268 TCCCCGTTTCCCCCCAACTTGGG - Intronic
1080971713 11:37285573-37285595 GCCCCCTATCCATACCACTGAGG + Intergenic
1085548095 11:77339576-77339598 GTCCCCTTTGCAAACAACTTTGG - Intronic
1087903726 11:103671521-103671543 GCTCCCTTTGCACACAGCTCAGG + Intergenic
1092930287 12:13309231-13309253 GCCTTATTTCCACACAACATGGG - Intergenic
1096357414 12:50952872-50952894 GCCCTCTTTCCCCTCAATTTTGG + Intergenic
1102316273 12:111890394-111890416 GCCCCCATCACACACCACTTGGG + Intronic
1106619433 13:31359206-31359228 GGCCCCTTTCTATTCAACTTAGG - Intergenic
1109633976 13:65089158-65089180 TCCCCCTTTCCCCACATCTCAGG + Intergenic
1114137730 14:19871009-19871031 GCCTCCTTTCCCCAGAAATTAGG - Intergenic
1118283390 14:64449477-64449499 GCCGCCTTTCCAGAGAACATGGG + Exonic
1120993804 14:90399647-90399669 TCCCCCTTTCCACTCAACAAGGG - Intronic
1121265104 14:92596722-92596744 GCCCCCTTTCTGCACAACTCTGG - Intronic
1122076624 14:99239162-99239184 GCCCCTTTTCCTCTCAATTTAGG + Intronic
1122272530 14:100574681-100574703 GCCCCCTCTCCAGGCACCTTGGG + Intronic
1122496764 14:102162343-102162365 GCCACCTTTTCACACAATATTGG + Intronic
1122931590 14:104935337-104935359 GGCCTCTTTCCACACACCTGGGG + Exonic
1123897442 15:24842507-24842529 GCCCCCCTTTCACACAGCTGAGG + Intronic
1133028169 16:2997590-2997612 CCCCCCTTTCCTCCCAATTTAGG - Intergenic
1133506107 16:6414074-6414096 AGCCCCTTTCCACAGTACTTGGG - Intronic
1133554798 16:6895647-6895669 GCCTCCTTTCCACAAAACATTGG - Intronic
1139383964 16:66552252-66552274 GCCCCATCTCCCAACAACTTGGG - Intronic
1140043503 16:71424921-71424943 CCCCCCTTTCCCCACACCTCTGG + Intergenic
1144809143 17:17987562-17987584 GTCCCCTTTCCTCACACCTGTGG - Intronic
1148790587 17:50170481-50170503 GGCCCCTTTCTAGGCAACTTGGG + Intronic
1152037110 17:77880323-77880345 GCCCCCTTTCCCCACCACACAGG - Intergenic
1152423620 17:80207204-80207226 GGGCCGTTTCCGCACAACTTTGG + Intronic
1153616122 18:6935781-6935803 CACCCCTTTCCACTTAACTTTGG + Intergenic
1156827073 18:41443807-41443829 CCCTCCTTTCCACACATCTCAGG - Intergenic
1161966279 19:7550921-7550943 GCCCCCTTTCCACCCATCTTCGG + Intronic
1164711436 19:30359689-30359711 GACCCCTCCCCACACCACTTGGG + Intronic
1165433494 19:35784931-35784953 GCCCCCTTTCCACACTCCCCAGG + Exonic
925815003 2:7738816-7738838 TCCCCAATTCCACACAACTTTGG - Intergenic
927990151 2:27442093-27442115 GCCTCCTTTCCACACAGGCTGGG - Exonic
928966375 2:36979382-36979404 TCCCCATTTCCCCCCAACTTAGG - Intronic
929179179 2:39015647-39015669 GCAGCCTTTCTCCACAACTTAGG - Intronic
929777952 2:44940034-44940056 GCGCCGTGTCCACACCACTTTGG - Intergenic
930327381 2:49937111-49937133 CCACCCTTTCCACAGAAATTAGG - Intronic
936245784 2:110826228-110826250 GCCCCTTGTTCACACACCTTCGG + Intronic
938858899 2:135345595-135345617 GCTCTCTTTCCACAAAAATTTGG - Exonic
941882202 2:170492472-170492494 GACCTCTTTCAACACAACGTGGG - Intronic
942025619 2:171907859-171907881 GCCTCTTTTCCCCACAACCTTGG + Intronic
942829783 2:180225740-180225762 GCTCCCTGTCCTCACAATTTGGG - Intergenic
946750634 2:222892613-222892635 GTCTCCTTTCCACAAAAGTTAGG - Intronic
1170936321 20:20813048-20813070 ACCCCATTTCCACAAAACATTGG + Intergenic
1172408505 20:34705914-34705936 GCCCCCTCTCCTGACCACTTGGG - Intronic
1175034756 20:55989328-55989350 GTCCCCCTTCCCCACACCTTGGG - Intergenic
1179889210 21:44327243-44327265 TCCCCCTCTCAACACAACCTAGG - Exonic
1181429560 22:22870667-22870689 GCCTCCTCTCCAGACAAGTTAGG - Intronic
1184190769 22:42892913-42892935 GGCCCCTGTCCACACAACAGTGG + Intronic
1184252666 22:43269625-43269647 GCGCCCTTCCCCCTCAACTTGGG + Intronic
950003641 3:9677215-9677237 GCCCCCTCTCCACAGCACTCAGG + Intronic
950698209 3:14721072-14721094 GCCCCTTTTCCACCCATCTTTGG + Intronic
957955026 3:87175389-87175411 CTCCCCTTTCCACACACCTGGGG - Intergenic
963603793 3:147397574-147397596 GCCACCATTCACCACAACTTTGG + Intronic
964732498 3:159882323-159882345 TCCCCCTGTCCACAGCACTTTGG - Intronic
965816475 3:172641771-172641793 GCCCTCTTACTACACCACTTTGG + Intronic
966860337 3:184228202-184228224 GCCCTCTTTCCATACTACCTGGG - Intronic
979664930 4:123300984-123301006 TCCCCCTTTCCAGATGACTTAGG - Intronic
982751333 4:159166019-159166041 GCCCCTTTTCCTTACATCTTTGG - Intronic
984652485 4:182285613-182285635 GCAGCCTTTCCAAACAACTTTGG - Intronic
986172482 5:5325854-5325876 GCCCCCTTTTCACCCATCTAGGG - Intergenic
992561951 5:77961155-77961177 AACCACTTTCCACACAGCTTAGG - Intergenic
996611458 5:125385367-125385389 GCCCCCTTTCCACATATAATAGG - Intergenic
998308246 5:141100840-141100862 GTTCCCTTTGGACACAACTTGGG - Exonic
999657970 5:153829080-153829102 GCACCCTCTCCATACACCTTTGG + Intergenic
1004789027 6:19003271-19003293 TCCCTCTCTCCACACAATTTAGG + Intergenic
1006599630 6:35216852-35216874 TCCCCCCTTCCACATGACTTTGG - Intronic
1008049037 6:46881256-46881278 GCCCCTTTTCCACACACCCCAGG + Intronic
1009912101 6:69943031-69943053 TTCCCCTTTCTCCACAACTTTGG + Intronic
1010058384 6:71591185-71591207 GCCCCCTTTACACACATCAAAGG + Intergenic
1012371577 6:98513803-98513825 GTTCCCTTTGCACACAACTGTGG + Intergenic
1014391514 6:120871721-120871743 GCCTCCTTCCCACTCTACTTGGG - Intergenic
1024929188 7:54652147-54652169 GCTCCCTTTCCTCAAAACTGGGG - Intergenic
1025708122 7:63885804-63885826 GCCCCATTTCAAGACAATTTGGG + Intergenic
1033419062 7:141189785-141189807 CCCTCCTCTCCCCACAACTTTGG - Intronic
1034413506 7:150953420-150953442 GCCCCCTCTCCACACAGGTCCGG + Intronic
1035863495 8:3055963-3055985 GCCCTCTGTCCACACGACATAGG + Intronic
1038607894 8:29027751-29027773 GTAACCTTTCCACACAAATTTGG - Intronic
1038803415 8:30769507-30769529 TTCCACTTTCCACACAACTGTGG - Intergenic
1042001439 8:64126935-64126957 TCCCTCTTTCCACTGAACTTAGG + Intergenic
1044535443 8:93352201-93352223 GCATCCTATCCTCACAACTTTGG + Intergenic
1047632672 8:126725462-126725484 GCCTCTTCTCCAGACAACTTAGG + Intergenic
1048641269 8:136364859-136364881 GCCTCTTATCCCCACAACTTTGG + Intergenic
1050042535 9:1511153-1511175 GTTCCCTTTCCTAACAACTTTGG + Intergenic
1059670132 9:116483431-116483453 TCCCTCTTTCCACACCACCTAGG - Intronic
1059886134 9:118746723-118746745 TCCCCATTTGCACACAATTTAGG + Intergenic
1060422928 9:123482527-123482549 GCCACCCTTCCTCACAAATTTGG - Intronic
1062398352 9:136361722-136361744 GCCCCCTTTCCACGCGACTGTGG + Intronic
1186436103 X:9544273-9544295 GCCCGCTTTCCAGACACCATGGG - Intronic
1187655274 X:21464327-21464349 GCCCCCTTTCCCCCAAACCTGGG - Intronic
1196986759 X:121282144-121282166 GTCCCCTTTCCCCACTACTTGGG - Intergenic
1198767058 X:140091191-140091213 GCCCCCTTTTCACACATTTTTGG - Intergenic
1201782761 Y:17741595-17741617 GCCACCTGAACACACAACTTTGG - Intergenic
1201818792 Y:18164393-18164415 GCCACCTGAACACACAACTTTGG + Intergenic