ID: 1072304125

View in Genome Browser
Species Human (GRCh38)
Location 10:94090527-94090549
Sequence CCTTCCTTATGGAAGGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072304118_1072304125 13 Left 1072304118 10:94090491-94090513 CCAAAGTTGTGTGGAAAGGGGGC 0: 1
1: 0
2: 1
3: 9
4: 95
Right 1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG No data
1072304113_1072304125 18 Left 1072304113 10:94090486-94090508 CCTGTCCAAAGTTGTGTGGAAAG 0: 1
1: 0
2: 0
3: 15
4: 83
Right 1072304125 10:94090527-94090549 CCTTCCTTATGGAAGGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072304125 Original CRISPR CCTTCCTTATGGAAGGTGCG GGG Intronic
No off target data available for this crispr