ID: 1072305170

View in Genome Browser
Species Human (GRCh38)
Location 10:94100322-94100344
Sequence GTGGTACCCCTGATTTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072305170_1072305176 21 Left 1072305170 10:94100322-94100344 CCTCCCTAAATCAGGGGTACCAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1072305176 10:94100366-94100388 CATAGTGAAAATGTTCTCAAGGG No data
1072305170_1072305175 20 Left 1072305170 10:94100322-94100344 CCTCCCTAAATCAGGGGTACCAC 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1072305175 10:94100365-94100387 ACATAGTGAAAATGTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072305170 Original CRISPR GTGGTACCCCTGATTTAGGG AGG (reversed) Intronic
905977481 1:42187428-42187450 GTGGTACACCTGGTCTAAGGAGG + Intronic
907641950 1:56199512-56199534 GTGGAACCCCTAACTTAGGTAGG - Intergenic
907858283 1:58325404-58325426 GAGGAACCCCTGGTTTAGAGAGG - Intronic
919610796 1:199743419-199743441 GTGGAATCTCTGATTTATGGAGG + Intergenic
1065768367 10:29053405-29053427 GTGGGATCCCTGATTTATAGTGG - Intergenic
1067715942 10:48691244-48691266 GTGGTCACCCTGACTTAGGGTGG + Intronic
1068433935 10:56966969-56966991 GTGGTACACCTGAGTAAGCGTGG - Intergenic
1069952465 10:72028797-72028819 GTGACACCTCTGATTTAGCGAGG - Intergenic
1072305170 10:94100322-94100344 GTGGTACCCCTGATTTAGGGAGG - Intronic
1074389519 10:113045287-113045309 GTGTTACCCCTGTTCTAGAGAGG + Intronic
1074717925 10:116236737-116236759 GTTGTACCCCAGCTTTTGGGGGG - Intronic
1076609337 10:131711363-131711385 GTGGTAGCCCTGGTTTAGGATGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1087236359 11:95723301-95723323 GTGCTCCCCCTCCTTTAGGGTGG - Intergenic
1088779833 11:113123589-113123611 GTGGTACCCCTGACTGGTGGTGG + Intronic
1098659186 12:73071692-73071714 GTGGTCACCCAGATTAAGGGTGG - Intergenic
1100952500 12:99867018-99867040 CTGGTGCCCCTGATTTAAGTTGG - Intronic
1120981676 14:90294927-90294949 GTGGTTCCCATGAGTTAGGAGGG + Intronic
1121639368 14:95475099-95475121 GTGGTGCCCCTGTCTGAGGGTGG - Intronic
1129740413 15:77987089-77987111 GGGGTTCCCAGGATTTAGGGGGG + Intronic
1145862389 17:28221730-28221752 ATGGTCTCCCTGACTTAGGGTGG + Intergenic
1156069554 18:33189889-33189911 GTGGTAGCCCTAATCTTGGGTGG + Intronic
1156176156 18:34549013-34549035 GTGGTACCACTTATTAAGGTGGG - Intronic
1156436867 18:37140559-37140581 TGAGTAGCCCTGATTTAGGGTGG - Intronic
1159724142 18:71932567-71932589 GAGGTACATCTGATTTTGGGGGG - Intergenic
1161880481 19:6947710-6947732 GTGGTGCCCATGATTTACTGAGG + Intergenic
1164964079 19:32465563-32465585 GTAGAACCCCTGATTTGGGAGGG + Intronic
932757945 2:74421817-74421839 GTGTTACCTCTGATCTAGGCCGG + Intronic
934770191 2:96902803-96902825 GGGGTACCCCAGATGGAGGGTGG - Intronic
936067363 2:109342647-109342669 GCCGTACCCCTGAGTAAGGGCGG - Intronic
941032604 2:160529557-160529579 GTGGATCTCCTGAATTAGGGAGG + Intergenic
942658405 2:178238804-178238826 GTAGAACCCCTTATTTTGGGGGG - Intronic
945379405 2:209121740-209121762 GTGCTAACCCAGATTAAGGGCGG + Intergenic
947752553 2:232540446-232540468 GTGGGACCCCTGATGGAAGGAGG - Intronic
1170430301 20:16269478-16269500 GTGGTACCTTTGAGTTAGAGGGG - Intergenic
1180218158 21:46339673-46339695 GTGGCAACCCAGATTGAGGGTGG + Intronic
1183197809 22:36365384-36365406 CTGGCAGCCCTGACTTAGGGTGG - Intronic
952106013 3:30070073-30070095 TTGGTAGCCCTGAGTTAGGCAGG - Intergenic
957247984 3:77736921-77736943 GTGCTAACCCAGATTAAGGGAGG + Intergenic
964909105 3:161756245-161756267 CTGTTACTCCTGATTTAGTGTGG + Intergenic
970094225 4:12444304-12444326 GTGCAACCCCTGATTTAGTCAGG - Intergenic
975644466 4:76532462-76532484 GTGGTACCCCTGATCCACAGGGG + Intronic
978949607 4:114542116-114542138 GTGGCCACCCAGATTTAGGGTGG - Intergenic
982271888 4:153598910-153598932 CTGGTACCCCTGGATTAGAGTGG + Intronic
984059974 4:174979549-174979571 GTGGCAACCCAGATTAAGGGTGG + Intergenic
1013937295 6:115613087-115613109 CTGGTCCTCCTGAGTTAGGGAGG - Intergenic
1015205258 6:130630922-130630944 GTGCTCCCCCAGATTAAGGGTGG - Intergenic
1016396839 6:143632771-143632793 GTGGTTGCCAGGATTTAGGGGGG - Intronic
1017758585 6:157550747-157550769 GTGGTATCCTGGCTTTAGGGAGG - Intronic
1026083315 7:67241436-67241458 GTGGTTCCTCTGATTTACAGAGG - Intergenic
1031861465 7:126984400-126984422 GGTGAACCCCTGATTGAGGGTGG - Intronic
1037833583 8:22203106-22203128 GTGGAATCCCTGACTTAGAGCGG - Intronic
1058099468 9:100902988-100903010 GTGAAACACCTGATTTAGGCAGG + Intergenic
1058261603 9:102840029-102840051 GTGCTCACCCTGATTAAGGGTGG + Intergenic
1059276027 9:113097946-113097968 GAGGTAGCCCTGATTTCTGGTGG - Intergenic
1060927895 9:127468032-127468054 GTGGTGCAGCTGATTTAGGTTGG + Intronic
1062339331 9:136087002-136087024 GAGATATCCCGGATTTAGGGTGG + Intronic
1188816300 X:34718699-34718721 GTGCTACCCCTTATTGATGGTGG - Intergenic
1198253309 X:134903152-134903174 GTGGTATCTCTGATTTGTGGAGG + Intronic
1202088168 Y:21161049-21161071 GTGGTCCCCATGTTTTTGGGTGG + Intergenic