ID: 1072306340

View in Genome Browser
Species Human (GRCh38)
Location 10:94111242-94111264
Sequence AATCCCACCCTGCAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072306340_1072306345 4 Left 1072306340 10:94111242-94111264 CCTTCCAGCTGCAGGGTGGGATT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1072306345 10:94111269-94111291 GGGAGGAATTCAGCCCCTTGCGG No data
1072306340_1072306352 26 Left 1072306340 10:94111242-94111264 CCTTCCAGCTGCAGGGTGGGATT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1072306352 10:94111291-94111313 GGCAGAGGTGGAGTGAAGAAAGG No data
1072306340_1072306346 5 Left 1072306340 10:94111242-94111264 CCTTCCAGCTGCAGGGTGGGATT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1072306346 10:94111270-94111292 GGAGGAATTCAGCCCCTTGCGGG No data
1072306340_1072306353 27 Left 1072306340 10:94111242-94111264 CCTTCCAGCTGCAGGGTGGGATT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1072306353 10:94111292-94111314 GCAGAGGTGGAGTGAAGAAAGGG No data
1072306340_1072306347 11 Left 1072306340 10:94111242-94111264 CCTTCCAGCTGCAGGGTGGGATT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1072306347 10:94111276-94111298 ATTCAGCCCCTTGCGGGCAGAGG No data
1072306340_1072306348 14 Left 1072306340 10:94111242-94111264 CCTTCCAGCTGCAGGGTGGGATT 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1072306348 10:94111279-94111301 CAGCCCCTTGCGGGCAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072306340 Original CRISPR AATCCCACCCTGCAGCTGGA AGG (reversed) Intronic
900859483 1:5217914-5217936 ATTCTCAGCCAGCAGCTGGAGGG + Intergenic
900962351 1:5933210-5933232 GATCCCACCCTGCAGAGGCAGGG + Exonic
902619828 1:17644387-17644409 GCCCACACCCTGCAGCTGGAAGG + Intronic
902684923 1:18070146-18070168 AACCCCTCCCTGCAGAGGGAGGG - Intergenic
904255667 1:29253001-29253023 AACCCCAACCTGCAGCGGGTCGG - Intronic
904438079 1:30512335-30512357 AAGCCCACCCTGAAGCCAGAGGG - Intergenic
904503294 1:30930121-30930143 AACCCAATCCTGCAGATGGAGGG + Intergenic
904615611 1:31747975-31747997 AAGCCCACACAGGAGCTGGATGG - Intronic
905331542 1:37204226-37204248 AATCTTTCCCTGCAGCTTGAAGG - Intergenic
905885824 1:41491376-41491398 AATCCCACCTGGCAGCTGCTGGG + Intergenic
906790828 1:48657438-48657460 CATTCCACGCTGCAGCCGGATGG - Intronic
907448270 1:54524072-54524094 AATCCCATTCTGCATCTGAATGG + Intergenic
908535547 1:65073195-65073217 AAGCCCAGCCAGCAGCTGGGAGG - Intergenic
912006350 1:104905426-104905448 AATTTCACCCTGCAGCATGAAGG + Intergenic
912331385 1:108823195-108823217 AATCCAGCCCTACATCTGGATGG - Intronic
915333061 1:155125589-155125611 AGTCCCACGCTGCAGCTGCTTGG - Intergenic
920932952 1:210406081-210406103 ACTCCCACCCTCCTCCTGGAGGG - Intronic
921317705 1:213907668-213907690 AATTCCACCCTCAGGCTGGAAGG + Intergenic
922213620 1:223503560-223503582 TACCCCACCCTCCAGCTGGGAGG - Intergenic
923329642 1:232910711-232910733 AGTCCCAGCCTGTATCTGGATGG - Intergenic
923761443 1:236848761-236848783 AATCGCTCTCTGCAGCTGGTGGG - Intronic
1067038168 10:42934105-42934127 AACCCGGCCCTGCAGGTGGAGGG - Intergenic
1067038675 10:42936779-42936801 AATCCCACCGTGGAGCTCCAAGG - Intergenic
1068706163 10:60078390-60078412 AATGCCACGCTGCAAATGGAAGG + Intronic
1069925631 10:71848629-71848651 AATGCCACCCTGAATCGGGATGG - Intronic
1072306340 10:94111242-94111264 AATCCCACCCTGCAGCTGGAAGG - Intronic
1072450739 10:95537688-95537710 CATTCCACCCTGATGCTGGAAGG + Intronic
1072617260 10:97058203-97058225 TTTCCCACCCAGCAGCTTGAGGG - Intronic
1074755121 10:116618767-116618789 AATTCCCACCAGCAGCTGGATGG - Intergenic
1074814594 10:117134701-117134723 AGCCCCACCCAGCAGCCGGAGGG + Intronic
1075300943 10:121323628-121323650 AATCTCACCATGTACCTGGAAGG - Intergenic
1077302288 11:1853000-1853022 AACCTCAACCTGCAGCCGGAAGG + Intronic
1078105481 11:8355598-8355620 AATCCCTGACTGCACCTGGAAGG - Intergenic
1081588135 11:44401644-44401666 AATCCCACACTGCACCAAGAAGG - Intergenic
1083288429 11:61676015-61676037 CATCCCATCCTGCAGCTGCTGGG + Intergenic
1083328363 11:61885217-61885239 AATCCCACACAGCAGCTGGTCGG + Intronic
1084716651 11:70878524-70878546 AAACCCACCATGCAGCCCGAGGG - Intronic
1084973385 11:72783332-72783354 CCTCCCACACTGCAGATGGAAGG - Intronic
1085706980 11:78795150-78795172 ACCCCCTCCCGGCAGCTGGAAGG + Intronic
1086001398 11:81989661-81989683 AATGCAACCCTGAATCTGGAGGG - Intergenic
1087034863 11:93745097-93745119 AAAACCACCCTGTGGCTGGAGGG - Intronic
1090407274 11:126484246-126484268 ACTCCTACCCTGCAACTGTAGGG - Intronic
1090531218 11:127592930-127592952 AAGCCCACCTTTTAGCTGGAAGG + Intergenic
1091261764 11:134240092-134240114 AATCCCAACCTCCATCTTGATGG - Exonic
1096580380 12:52581148-52581170 AGCCCCACCCTGCGGGTGGAAGG + Intergenic
1098217793 12:68238433-68238455 ACTCCCACCCAGCAGCAGGATGG - Intergenic
1103139941 12:118539832-118539854 AATCCCATCCTTCAGCTTGAGGG - Intergenic
1104345598 12:127993846-127993868 TATTCCACCCTGCAGCAGGGAGG - Intergenic
1106144212 13:27037216-27037238 AATGCCCCCCTGAAGCTGGCTGG - Intergenic
1107659636 13:42625675-42625697 TACTCCACCCTGCAACTGGATGG + Intergenic
1114911079 14:27198160-27198182 ATTCCAAACCTGTAGCTGGATGG - Intergenic
1118137903 14:63047667-63047689 ACTCCCTCCCTGCAGTTGGTGGG + Intronic
1119322900 14:73742083-73742105 AGTCCCACCCTGCAGCTTCATGG - Intronic
1121085565 14:91143643-91143665 AACCCCACCCAGGAGCTGAAGGG - Intronic
1121839119 14:97118060-97118082 AATCCCATCCTGAAGCTGAATGG + Intergenic
1127617037 15:60696423-60696445 AATCCAAGCCAGCAGCTAGAGGG - Intronic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1131532495 15:93205683-93205705 CAACCCTCTCTGCAGCTGGAAGG + Intergenic
1131543037 15:93290387-93290409 CATTCCACCCTGCAGCTGGGAGG - Intergenic
1132387432 15:101410351-101410373 AATGCCACCCTGAAGCAGAAGGG + Intronic
1132793365 16:1706149-1706171 AGTCCCGCCCTCCAGCCGGAGGG - Intergenic
1134633877 16:15777636-15777658 ATTCCCATCCTGCAGCTAGGAGG - Intronic
1134690028 16:16185020-16185042 AATCCTTCCCGGCAGCTGCAGGG + Exonic
1134778896 16:16877576-16877598 ATGCCCACCCTAGAGCTGGAGGG - Intergenic
1136132148 16:28229759-28229781 TAGCCCCTCCTGCAGCTGGATGG - Intergenic
1136473817 16:30499358-30499380 ACTTACACTCTGCAGCTGGATGG + Exonic
1137847063 16:51700824-51700846 AATCTGACCATGAAGCTGGAGGG + Intergenic
1137896687 16:52220131-52220153 ACTCCCTACCTGCACCTGGATGG + Intergenic
1138728464 16:59166966-59166988 AGTCCCACCCTGCACTTGGAAGG + Intergenic
1139582140 16:67880085-67880107 AGCCCCAAGCTGCAGCTGGATGG + Exonic
1139711387 16:68779179-68779201 AAGCCCGCACTGCAGGTGGAAGG - Intronic
1140479390 16:75254217-75254239 CAGCCCACCCTGCAGCAGGAAGG + Intronic
1141726931 16:85795787-85795809 AACCCCACCTTGAAGCTGGTGGG + Intronic
1143179197 17:4973691-4973713 GATCCCACGCTCCACCTGGAAGG - Exonic
1144630583 17:16870201-16870223 GACCCCACCCTGCAGGTGGCAGG - Intergenic
1144650742 17:17005254-17005276 GACCCCACCCTGCAGGTGGCAGG + Intergenic
1144929942 17:18851063-18851085 AATCCCTCCCTTAAGCTGGAGGG - Intronic
1146889641 17:36498102-36498124 AATCCAAACCTGCAGCTGATTGG + Intronic
1147191783 17:38742166-38742188 AAACCAAACCTGCACCTGGAAGG + Intronic
1147427314 17:40352081-40352103 AATCCCACCCTGCAGGCCGGGGG - Intronic
1147692136 17:42322826-42322848 AAACCAATCCTTCAGCTGGAAGG + Intronic
1148844737 17:50522931-50522953 AATCCCAACCTGCCTCTGGAAGG - Exonic
1149597328 17:57872134-57872156 ACTCCCACCCTGCAGGGGAAAGG + Intronic
1151587749 17:75021006-75021028 AATCACCCTCTGCAGCTGGGAGG + Exonic
1152307992 17:79532293-79532315 AGTCCCAGCCTGGAGCTGGCTGG - Intergenic
1152332396 17:79680749-79680771 AATCCCACCCTGCCCCAGGCAGG + Intergenic
1152784355 17:82240290-82240312 AGTCCCACCCAGCAGCTGAAGGG + Intronic
1153986035 18:10351652-10351674 CATCTCACCCTCCAGCTGCATGG + Intergenic
1155074047 18:22339855-22339877 AAAGCCACCCTGCAGCAGGCTGG + Intergenic
1156020435 18:32594154-32594176 AATACCATCCTCCAGCTGGCAGG + Intergenic
1160113322 18:76054455-76054477 AATCCAAGCCTGTAGATGGAGGG + Intergenic
1160779373 19:871046-871068 GCTGCCACCCTGCAGCTCGACGG - Exonic
1160832753 19:1111319-1111341 AAACCCACCCGGCAGCTGCTGGG + Intronic
1161341935 19:3747779-3747801 ACACCCACCCCACAGCTGGATGG + Exonic
1162609709 19:11739352-11739374 CAGGCCACCCTGCAGCAGGAGGG + Intergenic
1162659219 19:12156390-12156412 AACCCCACCCTGCGGCCGAAGGG + Intronic
1162689185 19:12414504-12414526 CAGGCCACCCTGCAGCAGGAGGG + Intronic
1163402376 19:17101871-17101893 ATTGCCAGCCTGCGGCTGGACGG + Exonic
1164686027 19:30167392-30167414 AACCCCACCCTGCAGTGGGCAGG - Intergenic
1164963594 19:32459231-32459253 AAACCCCCCCAGCAGCTTGATGG - Intronic
1165116792 19:33533502-33533524 AATCCCACCCTCCTTCTGGATGG + Intergenic
1165355140 19:35299805-35299827 AACACCACCCTGCAGTTCGAGGG + Exonic
1166634577 19:44438971-44438993 AACCCCAACTTGCAGCTGGTTGG + Intronic
1167871896 19:52377583-52377605 AACCCCAACCTGTAGCTGGTTGG - Intronic
932579855 2:72986049-72986071 CATCTGACCCTGCAGCTGAATGG + Intronic
932769693 2:74493622-74493644 AGTCCCACCTTTCAGCTTGATGG + Exonic
933727651 2:85435756-85435778 ATTCCCATCCGGCGGCTGGATGG + Exonic
936271185 2:111050476-111050498 AAAGCCAGCCTGCACCTGGAAGG - Intronic
939756385 2:146117274-146117296 AAACCCACCCTCCATCTGGGTGG - Intergenic
941331553 2:164183638-164183660 AATCTCACCATGTACCTGGAAGG + Intergenic
943021028 2:182574233-182574255 AAACCCACCCTTAATCTGGATGG - Intergenic
945848769 2:214980558-214980580 AAGCCCACCCTGCTCCAGGAAGG + Exonic
947522878 2:230862112-230862134 TGTCCCACCCTGCAGCTCCAAGG + Intergenic
948619727 2:239226851-239226873 AATGCCACCCTGTGGCTGGCAGG - Intronic
1171183473 20:23108311-23108333 CATCCCATGCTCCAGCTGGAGGG + Intergenic
1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG + Intronic
1172066789 20:32227073-32227095 ACTTCCCCCCTCCAGCTGGAGGG + Intronic
1172446124 20:34994385-34994407 ACTCACAGCCTGCAGCTGCAGGG - Exonic
1173293924 20:41739060-41739082 AATCCAGCCTTGCTGCTGGAGGG - Intergenic
1174274040 20:49390646-49390668 CAGCCTCCCCTGCAGCTGGATGG + Intronic
1174282950 20:49452590-49452612 GAGCCCACCCTGAAGATGGAAGG + Intronic
1175908582 20:62393891-62393913 AGCCCCACCCTGCAGCAGGGGGG + Intronic
1178351421 21:31874662-31874684 GCTCCCACCCTGAGGCTGGAGGG - Intronic
1180237543 21:46472782-46472804 AATTCCTCCCTGTAGCTGGTTGG + Intronic
1180534821 22:16387815-16387837 CACCACACCCTGCAGCGGGAGGG + Intergenic
1180701195 22:17782231-17782253 AATCACACCCAGCAGAGGGAAGG + Intergenic
1180885589 22:19241029-19241051 ACACCCACCCTGCAGCCGGGAGG + Intronic
1181623251 22:24105234-24105256 AATCCCACCCTGGAAGTAGAAGG + Intronic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
1182882010 22:33741862-33741884 ATGCCCACCCTCCAGATGGATGG + Intronic
1183279719 22:36925477-36925499 AATCCCATCATGTAGATGGATGG + Intronic
1184190596 22:42892025-42892047 AAGCCCATCCTGCAGGAGGAAGG + Intronic
1184354207 22:43967735-43967757 GATTCCACCCTGCAGGTGAAAGG - Intronic
1184671388 22:46013803-46013825 ACCCCCACCCTGCACCTGGACGG - Intergenic
951464878 3:22990684-22990706 CATCCCACTCTGCAGCCGGATGG + Intergenic
952150286 3:30581597-30581619 AGTCCCACCTTGAAGCAGGAAGG - Intergenic
952968709 3:38637235-38637257 CATCCCTCCCTGCATCCGGAAGG + Intronic
953907106 3:46873916-46873938 GATGCCTCCCTGAAGCTGGAGGG - Intronic
954917784 3:54163726-54163748 AATGTCACACTGCAGCTGCAAGG + Intronic
954925600 3:54231612-54231634 AATGCCACCTTGCATCTGAAAGG + Intronic
954971267 3:54653560-54653582 AGGCCCTCCCTGCAGCTGAAGGG + Intronic
956420932 3:69085605-69085627 AACCCTACCCTGGAGCTGGCTGG + Intronic
956509989 3:69982837-69982859 AAACCCACCCTTAATCTGGAGGG + Intergenic
957367794 3:79249204-79249226 ATGCCCACCCAGCAGCTGCAAGG - Intronic
957636807 3:82796910-82796932 AATCCCTTCCTGCAGCTTGTGGG - Intergenic
959081060 3:101801590-101801612 AGCCCCAGCCTGCAGCTTGAGGG - Exonic
959120424 3:102225669-102225691 CATCCCATCTTACAGCTGGAAGG + Intronic
960439673 3:117671313-117671335 AAGCCCAGTCAGCAGCTGGATGG - Intergenic
962922076 3:139959251-139959273 ACTACCACCCCACAGCTGGAGGG - Intronic
963139856 3:141938205-141938227 ACTCGCACCCTGCTGCAGGACGG - Intergenic
964710180 3:159663438-159663460 AAACACATCCTGCACCTGGATGG + Intronic
966379198 3:179326210-179326232 AATCCCAGCCTCCTGCTGGCGGG + Intronic
969325437 4:6441367-6441389 GCTCCTCCCCTGCAGCTGGAGGG - Intronic
970309880 4:14771152-14771174 ACTCCCAGCCTGCAGCTGAAGGG - Intergenic
973641812 4:52910718-52910740 AATCCCCACATGCAGCAGGAGGG + Intronic
975651444 4:76597533-76597555 GCACCCACCCTCCAGCTGGATGG + Intronic
978382533 4:108144653-108144675 ATTCCCACACAGCTGCTGGAGGG + Intronic
981538470 4:145824501-145824523 ATTGCCACCCTGAGGCTGGAGGG + Intronic
982114557 4:152086958-152086980 AATGCTACCATGCACCTGGAAGG + Intergenic
982260231 4:153488369-153488391 CACCCCGTCCTGCAGCTGGAGGG + Intronic
982602934 4:157474643-157474665 AATCTCAAGCTGCAGCTCGAAGG + Intergenic
984324007 4:178228404-178228426 AATCAAACCCAGCAGCTGAAAGG + Intergenic
984812850 4:183810193-183810215 AGTCCCTCCCTGCAACTGCAAGG - Intergenic
985145307 4:186889641-186889663 ATGCCCACACTGGAGCTGGAGGG - Intergenic
985501579 5:251140-251162 CAGCCCACCCTGCAGAAGGAAGG - Intronic
985670389 5:1203765-1203787 AAGCCCACACTGCAGCCAGAGGG + Intronic
985936735 5:3103162-3103184 CTTCCCACCCTGCAGATGGATGG - Intergenic
986151372 5:5133184-5133206 AAGCCCCCCCAGCAGCAGGATGG + Intergenic
986253265 5:6080621-6080643 AAACCCACCCTGCAGAGGGACGG + Intergenic
987155277 5:15082868-15082890 AATCTCACCCTGTAAATGGAAGG - Intergenic
988681521 5:33488786-33488808 GTTCTCAGCCTGCAGCTGGACGG + Intergenic
990511338 5:56492107-56492129 CATCCCACACTGCAGGTGGAAGG - Intergenic
990739732 5:58900184-58900206 AATTCCATCCTCCAGCTGCATGG + Intergenic
994044986 5:95297384-95297406 GATCCCAACCTGAAACTGGAGGG - Intergenic
996134607 5:119824303-119824325 AATCCCACCCTGTGGCAGAAGGG + Intergenic
996629099 5:125606406-125606428 AAGCCAAGCCTCCAGCTGGATGG - Intergenic
997560162 5:134839603-134839625 ATTCATACCCTGCAGCTGAAGGG + Intronic
998160281 5:139809237-139809259 GAACCCACACTCCAGCTGGAAGG + Intronic
998605702 5:143632541-143632563 AATCCCAACTTGAAGCTGGTTGG - Intergenic
999065402 5:148680216-148680238 AAACCCACCCTGAATCTGGGTGG + Intergenic
1000966602 5:167665023-167665045 AATCACACTCTGCAAATGGAGGG + Intronic
1001313929 5:170629641-170629663 GATGCCACCCTGCAGGGGGAGGG - Intronic
1002646761 5:180660984-180661006 AATCACACACTTTAGCTGGATGG - Intergenic
1003074565 6:2971689-2971711 AACCCCACCCGCCAGCCGGAGGG + Intronic
1003404413 6:5816702-5816724 AAGCCCAACCTGCAGGTGGGAGG + Intergenic
1003694189 6:8386710-8386732 AATATCTCACTGCAGCTGGAAGG - Intergenic
1005586321 6:27279813-27279835 GAGCCCAGCCTGCACCTGGAGGG + Intergenic
1005976603 6:30804884-30804906 AATCCCAACTTGAAGCTGGTGGG - Intergenic
1006435071 6:34021787-34021809 AGGCTCAGCCTGCAGCTGGAGGG - Intronic
1006929250 6:37677906-37677928 TATCTCCCCCTGCAGCTGGGTGG - Intronic
1007185368 6:39966860-39966882 ACACCCACCCTCCAGCAGGAGGG - Intergenic
1007221732 6:40284178-40284200 AATGCCACTCTGAAGCTGCAAGG + Intergenic
1007345216 6:41223905-41223927 CTTCCCAAACTGCAGCTGGAGGG - Intergenic
1013374744 6:109503731-109503753 ATACCCACCCTGCAGCTGCTGGG + Intronic
1016340736 6:143059825-143059847 AATCCGAACCTGCAACTGGTTGG + Intergenic
1016840144 6:148517537-148517559 AATCCCAACCTTGACCTGGATGG - Intronic
1018085856 6:160300577-160300599 AATCCCATCTGGCACCTGGATGG - Intergenic
1018829537 6:167432830-167432852 AATGCCACCCAACAGCTGAAGGG - Intergenic
1019524543 7:1474831-1474853 CGCCCCTCCCTGCAGCTGGACGG - Exonic
1019780210 7:2935328-2935350 ACTCCCACTCTGCAGACGGATGG + Intronic
1019838735 7:3417205-3417227 AACCTCAGCCTGCAGCTGTAGGG - Intronic
1020230930 7:6317966-6317988 AAGTCCAGCCTGGAGCTGGAAGG + Intergenic
1020248539 7:6449250-6449272 GAAACCACCCTGCAGCTGGCGGG + Intronic
1022222676 7:28329387-28329409 TACCCCATTCTGCAGCTGGAAGG - Intronic
1023865816 7:44237890-44237912 GCTGCCACCCTGCAGCTGGCCGG + Intronic
1024097227 7:45992032-45992054 ACTGCCACCCTGCACTTGGACGG - Intergenic
1026738625 7:72964681-72964703 AATCCCAGCATAAAGCTGGAGGG - Intronic
1027105109 7:75400388-75400410 AATCCCAGCATAAAGCTGGAGGG + Intronic
1034860571 7:154591617-154591639 ACTCCCAGCATGCAGCTGGGCGG - Intronic
1034975640 7:155448078-155448100 CATGCAACCCTGCAGGTGGAGGG + Intergenic
1034982656 7:155488722-155488744 CATCCATCCCTGCAGCTGGAGGG + Intronic
1035452369 7:158985738-158985760 GATCTGACCCTGCAGCTGGCTGG - Intergenic
1035455366 7:159005499-159005521 ACTCCCACCCTGCAGCCACAAGG - Intergenic
1035727864 8:1835620-1835642 CTTCCCACCCTGCTGCTGGATGG + Intronic
1035746768 8:1966607-1966629 AATCCCAGACAGCAGCCGGAAGG + Intergenic
1036984634 8:13514764-13514786 AAACACCCTCTGCAGCTGGAGGG + Exonic
1038983888 8:32788247-32788269 AATCTCACTCATCAGCTGGAGGG - Intergenic
1039075949 8:33690370-33690392 AATTTCACTCTGCAGATGGAAGG - Intergenic
1040548908 8:48423351-48423373 AATCCTACCCTGCAGTGTGATGG - Intergenic
1040991252 8:53352656-53352678 AATCTCACCCGGCAGCTGCTGGG + Intergenic
1042359506 8:67866781-67866803 AGTCCCTGCCAGCAGCTGGATGG - Intergenic
1042745775 8:72103997-72104019 AATCTCACCTAGCAGCTGCAGGG + Intronic
1046536130 8:115513251-115513273 AATCCCAAACTGCAGCAGAAGGG + Intronic
1046848386 8:118944482-118944504 AATCCCACCAAGCTTCTGGAAGG + Intronic
1047779501 8:128099961-128099983 AAACCCACCCTGCGGCTGGCTGG - Intergenic
1048770422 8:137889279-137889301 AAGGGCACCCTGCAGCTGGATGG - Intergenic
1051143793 9:14005942-14005964 CATCACTCCCAGCAGCTGGAAGG + Intergenic
1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG + Intronic
1054868975 9:70031686-70031708 AATCCCACACTGAAGCCAGAAGG - Intergenic
1056331342 9:85523480-85523502 AGGCCCACACTGAAGCTGGAGGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061840814 9:133357556-133357578 AATTCCACTCTGAAGCTGGGTGG - Intronic
1203745508 Un_GL000218v1:38854-38876 ACCCCCATCCTGCAGCTGGCTGG - Intergenic
1187912580 X:24124580-24124602 GAACCCACCCAGAAGCTGGAAGG - Intergenic
1192145619 X:68680356-68680378 AAGCCCAGCCTGGAGCTGGTGGG - Intronic
1193433320 X:81439026-81439048 AGACCCACCCTGCATCTGGTGGG - Intergenic
1195687710 X:107601310-107601332 AAGCCCACCCTGCAGAAGCAGGG + Exonic
1197481040 X:126986162-126986184 AATCCCACCCAGCAGCTGCCGGG - Intergenic
1199022850 X:142902673-142902695 AGACCCACCCTGCATCTGGATGG - Intergenic
1199770294 X:150970888-150970910 AAGCCCTCCCTGCTGCTGTAGGG - Intergenic