ID: 1072306568

View in Genome Browser
Species Human (GRCh38)
Location 10:94113478-94113500
Sequence CTGAGTGTTCAGAGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072306562_1072306568 -4 Left 1072306562 10:94113459-94113481 CCTGTATTCCAAATAGCACCTGA 0: 1
1: 0
2: 0
3: 16
4: 136
Right 1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG No data
1072306560_1072306568 21 Left 1072306560 10:94113434-94113456 CCTGGTTGGAGATGTTTAGTTAC 0: 1
1: 0
2: 0
3: 6
4: 129
Right 1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG No data
1072306561_1072306568 -1 Left 1072306561 10:94113456-94113478 CCACCTGTATTCCAAATAGCACC 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072306568 Original CRISPR CTGAGTGTTCAGAGGGTGGA TGG Intronic
No off target data available for this crispr