ID: 1072308435

View in Genome Browser
Species Human (GRCh38)
Location 10:94130881-94130903
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072308435_1072308442 15 Left 1072308435 10:94130881-94130903 CCTGGCCCGCAGGGCAGTGAGAG No data
Right 1072308442 10:94130919-94130941 CCATTCGTCAGTGTCACCGAAGG No data
1072308435_1072308438 -8 Left 1072308435 10:94130881-94130903 CCTGGCCCGCAGGGCAGTGAGAG No data
Right 1072308438 10:94130896-94130918 AGTGAGAGTCTTCTACTCCCTGG No data
1072308435_1072308443 18 Left 1072308435 10:94130881-94130903 CCTGGCCCGCAGGGCAGTGAGAG No data
Right 1072308443 10:94130922-94130944 TTCGTCAGTGTCACCGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072308435 Original CRISPR CTCTCACTGCCCTGCGGGCC AGG (reversed) Intronic