ID: 1072308437

View in Genome Browser
Species Human (GRCh38)
Location 10:94130887-94130909
Sequence AGAAGACTCTCACTGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072308437_1072308442 9 Left 1072308437 10:94130887-94130909 CCGCAGGGCAGTGAGAGTCTTCT No data
Right 1072308442 10:94130919-94130941 CCATTCGTCAGTGTCACCGAAGG No data
1072308437_1072308443 12 Left 1072308437 10:94130887-94130909 CCGCAGGGCAGTGAGAGTCTTCT No data
Right 1072308443 10:94130922-94130944 TTCGTCAGTGTCACCGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072308437 Original CRISPR AGAAGACTCTCACTGCCCTG CGG (reversed) Intronic