ID: 1072308438 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:94130896-94130918 |
| Sequence | AGTGAGAGTCTTCTACTCCC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1072308435_1072308438 | -8 | Left | 1072308435 | 10:94130881-94130903 | CCTGGCCCGCAGGGCAGTGAGAG | No data | ||
| Right | 1072308438 | 10:94130896-94130918 | AGTGAGAGTCTTCTACTCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1072308438 | Original CRISPR | AGTGAGAGTCTTCTACTCCC TGG | Intronic | ||