ID: 1072308438 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:94130896-94130918 |
Sequence | AGTGAGAGTCTTCTACTCCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072308435_1072308438 | -8 | Left | 1072308435 | 10:94130881-94130903 | CCTGGCCCGCAGGGCAGTGAGAG | No data | ||
Right | 1072308438 | 10:94130896-94130918 | AGTGAGAGTCTTCTACTCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072308438 | Original CRISPR | AGTGAGAGTCTTCTACTCCC TGG | Intronic | ||