ID: 1072308443

View in Genome Browser
Species Human (GRCh38)
Location 10:94130922-94130944
Sequence TTCGTCAGTGTCACCGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072308437_1072308443 12 Left 1072308437 10:94130887-94130909 CCGCAGGGCAGTGAGAGTCTTCT No data
Right 1072308443 10:94130922-94130944 TTCGTCAGTGTCACCGAAGGAGG No data
1072308435_1072308443 18 Left 1072308435 10:94130881-94130903 CCTGGCCCGCAGGGCAGTGAGAG No data
Right 1072308443 10:94130922-94130944 TTCGTCAGTGTCACCGAAGGAGG No data
1072308436_1072308443 13 Left 1072308436 10:94130886-94130908 CCCGCAGGGCAGTGAGAGTCTTC No data
Right 1072308443 10:94130922-94130944 TTCGTCAGTGTCACCGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072308443 Original CRISPR TTCGTCAGTGTCACCGAAGG AGG Intronic