ID: 1072311607

View in Genome Browser
Species Human (GRCh38)
Location 10:94161649-94161671
Sequence CAGGGTAATCAGACAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9099
Summary {0: 2, 1: 65, 2: 2951, 3: 4590, 4: 1491}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072311607_1072311616 22 Left 1072311607 10:94161649-94161671 CCTTCTCCTGTCTGATTACCCTG 0: 2
1: 65
2: 2951
3: 4590
4: 1491
Right 1072311616 10:94161694-94161716 TGAATATGAGTGGTGAGAGAGGG 0: 63
1: 10577
2: 5629
3: 3292
4: 3540
1072311607_1072311615 21 Left 1072311607 10:94161649-94161671 CCTTCTCCTGTCTGATTACCCTG 0: 2
1: 65
2: 2951
3: 4590
4: 1491
Right 1072311615 10:94161693-94161715 TTGAATATGAGTGGTGAGAGAGG 0: 68
1: 11004
2: 6793
3: 4711
4: 4090
1072311607_1072311614 12 Left 1072311607 10:94161649-94161671 CCTTCTCCTGTCTGATTACCCTG 0: 2
1: 65
2: 2951
3: 4590
4: 1491
Right 1072311614 10:94161684-94161706 AACACTATTTTGAATATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072311607 Original CRISPR CAGGGTAATCAGACAGGAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr