ID: 1072311607 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:94161649-94161671 |
Sequence | CAGGGTAATCAGACAGGAGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 9099 | |||
Summary | {0: 2, 1: 65, 2: 2951, 3: 4590, 4: 1491} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1072311607_1072311616 | 22 | Left | 1072311607 | 10:94161649-94161671 | CCTTCTCCTGTCTGATTACCCTG | 0: 2 1: 65 2: 2951 3: 4590 4: 1491 |
||
Right | 1072311616 | 10:94161694-94161716 | TGAATATGAGTGGTGAGAGAGGG | 0: 63 1: 10577 2: 5629 3: 3292 4: 3540 |
||||
1072311607_1072311615 | 21 | Left | 1072311607 | 10:94161649-94161671 | CCTTCTCCTGTCTGATTACCCTG | 0: 2 1: 65 2: 2951 3: 4590 4: 1491 |
||
Right | 1072311615 | 10:94161693-94161715 | TTGAATATGAGTGGTGAGAGAGG | 0: 68 1: 11004 2: 6793 3: 4711 4: 4090 |
||||
1072311607_1072311614 | 12 | Left | 1072311607 | 10:94161649-94161671 | CCTTCTCCTGTCTGATTACCCTG | 0: 2 1: 65 2: 2951 3: 4590 4: 1491 |
||
Right | 1072311614 | 10:94161684-94161706 | AACACTATTTTGAATATGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1072311607 | Original CRISPR | CAGGGTAATCAGACAGGAGA AGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |