ID: 1072314407

View in Genome Browser
Species Human (GRCh38)
Location 10:94188009-94188031
Sequence CTGTGAGTACCTAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 200}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072314407 Original CRISPR CTGTGAGTACCTAGGGAAGG GGG (reversed) Intronic
900466023 1:2825887-2825909 CTGTGAGGACACAGAGAAGGCGG - Intergenic
900616518 1:3567955-3567977 CTGTGAGACCCTTGGGAAGAAGG - Intronic
900704843 1:4073962-4073984 CTGTGAGCCCTGAGGGAAGGGGG + Intergenic
901158070 1:7154009-7154031 CTGTGTGTACCTGGGGACAGTGG + Intronic
901301068 1:8200473-8200495 CGGTGACGACCCAGGGAAGGAGG + Intergenic
901795582 1:11677477-11677499 CTGTGAGCACACAGGGACGGGGG + Intronic
902368081 1:15990298-15990320 CTGTGGGTACCAAGGGCAGCTGG - Intergenic
904474616 1:30756962-30756984 CTGTGAGTCACCAGGAAAGGAGG + Intronic
906294774 1:44642841-44642863 CTGCGTGTACTTGGGGAAGGGGG + Intronic
907751725 1:57269480-57269502 CTGTGAGTGGCCAGGGAGGGGGG - Intronic
908810724 1:67979379-67979401 CTGTGAATTCCTAGAAAAGGAGG - Intergenic
909368830 1:74860658-74860680 ATGTGATTATGTAGGGAAGGGGG + Intergenic
911809711 1:102260447-102260469 CTGTGAGAACCTAAGTAAGCCGG - Intergenic
913223660 1:116679756-116679778 CGGCCAGTACCCAGGGAAGGGGG - Intergenic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
914005792 1:143731390-143731412 CTGTCAGTATCCAGGGAATGGGG - Intergenic
916619848 1:166485451-166485473 CTGGGAGTACCTGGGGCAGGTGG - Intergenic
916858237 1:168774295-168774317 CTTTTAGCAGCTAGGGAAGGTGG - Intergenic
917096538 1:171404203-171404225 CTGTGGATACCCAGTGAAGGTGG - Intergenic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
921512140 1:216045038-216045060 CTGTGAGCACCAAGAGAAGAGGG + Intronic
921713726 1:218397848-218397870 CGGTGAGTACCTCAGGCAGGAGG + Intronic
922246175 1:223799939-223799961 CTCAGAGTACCAAAGGAAGGTGG + Exonic
924577399 1:245292792-245292814 CAGCGAGAACCGAGGGAAGGTGG - Intronic
1063368136 10:5503900-5503922 CTAGGAGTACCCAGGAAAGGGGG - Intergenic
1063614146 10:7587865-7587887 CTGTCTGAACCTGGGGAAGGAGG - Intronic
1064410238 10:15098156-15098178 CGGTGAGAAACTAGGAAAGGTGG - Intronic
1065783866 10:29194915-29194937 ATATGAGTTCCTAGGGAAGTCGG - Intergenic
1067068321 10:43115874-43115896 CTGTGGGTTCCCAGGGAATGTGG + Intronic
1067781348 10:49209558-49209580 CTGTGAAAGCCTTGGGAAGGAGG - Intergenic
1069953510 10:72035755-72035777 CTGAGAGGACCTAGGGCTGGCGG + Intergenic
1072314398 10:94187967-94187989 CTGTGCGTACCTAGGGACCAGGG - Intronic
1072314407 10:94188009-94188031 CTGTGAGTACCTAGGGAAGGGGG - Intronic
1072665469 10:97389482-97389504 ATGTGAGCACCGAGGGAAGGGGG + Intronic
1073317585 10:102593720-102593742 ATGTGAGTACCCATGCAAGGTGG + Exonic
1073564915 10:104526701-104526723 CTGAGAGAGGCTAGGGAAGGTGG + Intergenic
1073938870 10:108670180-108670202 ATGTGAGCACACAGGGAAGGAGG + Intergenic
1075540218 10:123306579-123306601 CAGGGAGGACCTAGGAAAGGTGG + Intergenic
1076030120 10:127150197-127150219 CAGTGAGTTCCTTGGGCAGGAGG - Intronic
1076252813 10:128997058-128997080 CCCTGAGTCCCTAAGGAAGGGGG - Intergenic
1076252972 10:128997618-128997640 CTCTGAGTCCCTAAGAAAGGGGG - Intergenic
1078007339 11:7541844-7541866 CCCTGAGTACCTAGAGAATGTGG - Intronic
1079022627 11:16922499-16922521 CTGTGAGTACCCAGGAATGAGGG - Intronic
1079502795 11:21120919-21120941 CTCTGAGGGCGTAGGGAAGGAGG - Intronic
1079576784 11:22013690-22013712 GTGTGAGAACATAGGGAAGGTGG + Intergenic
1081037094 11:38162416-38162438 CTATGAATCCCTAGGGATGGTGG + Intergenic
1081951968 11:47052144-47052166 CTGTGTGTACCTGTGGAAGGTGG + Intronic
1083760067 11:64810715-64810737 CCCTGAGTATCTCGGGAAGGAGG - Intronic
1085274796 11:75291606-75291628 CTGTTGGCAGCTAGGGAAGGGGG - Intronic
1085447032 11:76607780-76607802 CTATGAGAACCTTGGGAATGGGG - Intergenic
1088059628 11:105631216-105631238 CTGTGATTATATTGGGAAGGAGG + Intronic
1089278453 11:117355655-117355677 CAGGGAGTTCCTGGGGAAGGTGG + Intronic
1091156332 11:133377549-133377571 CTGGGAGTTCAAAGGGAAGGTGG - Intronic
1091206806 11:133827134-133827156 CTGTAGGTATCTGGGGAAGGGGG - Intergenic
1091663719 12:2403397-2403419 CTGTGAGGACCCAGGGAGGAGGG + Intronic
1093017690 12:14171160-14171182 CAGTGACTGCCCAGGGAAGGGGG + Intergenic
1094500679 12:31018288-31018310 CTGAGTGGGCCTAGGGAAGGAGG + Intergenic
1094696113 12:32820609-32820631 CTGTTACTACCAAAGGAAGGAGG - Intronic
1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG + Intergenic
1097055032 12:56244030-56244052 ATGTGAGTGCCTGGGGAAGGGGG - Exonic
1097260277 12:57715969-57715991 CGGTGAGTAATTAGAGAAGGAGG + Exonic
1102348570 12:112175344-112175366 ATGTGAGGACCTTGAGAAGGTGG + Intronic
1104427498 12:128690124-128690146 CTGTAAGGACCCAGGGACGGTGG - Intronic
1104655980 12:130574345-130574367 GGCTGAGTTCCTAGGGAAGGAGG - Intronic
1105948671 13:25210713-25210735 CTGTGTGACCCTAGGGCAGGAGG + Intergenic
1107792365 13:44015340-44015362 CTGGGAGCAACTTGGGAAGGGGG + Intergenic
1110474635 13:75899823-75899845 CTGTGAGAAGCTAAGGAGGGCGG + Intergenic
1114896916 14:27002222-27002244 CCAGGAGTTCCTAGGGAAGGAGG + Intergenic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1119007240 14:70942969-70942991 AAGTGAGTACCCAGCGAAGGGGG - Intronic
1121017075 14:90555391-90555413 ATAAGAGGACCTAGGGAAGGGGG + Intronic
1121288863 14:92758153-92758175 GTATGAGTACCCAGGGAAGGGGG - Intergenic
1121431580 14:93891850-93891872 CTGTGACTGCCTTGGGACGGTGG - Intergenic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1124095358 15:26644023-26644045 CTGAGGGTACCCAGGGCAGGAGG + Intronic
1125687818 15:41573814-41573836 GTGTGAGTATCCTGGGAAGGGGG + Exonic
1126228151 15:46295405-46295427 ATGTGGCTACCTGGGGAAGGTGG - Intergenic
1129055118 15:72813849-72813871 CTCTGGGGAGCTAGGGAAGGAGG - Intergenic
1129296322 15:74602249-74602271 CTCTGAGAACCTGGGGCAGGGGG - Intronic
1131421061 15:92305788-92305810 ATGTGAGTACTAAGGGAAGCTGG - Intergenic
1132138721 15:99370468-99370490 CTATGAGTATCTTGGGAAGGGGG + Intronic
1135882559 16:26272676-26272698 CAGTGATTACCTAGGGAATAGGG + Intergenic
1138363874 16:56456332-56456354 GCCTGTGTACCTAGGGAAGGAGG - Intronic
1139589224 16:67924182-67924204 CTGTGAGCAGCTAGGCCAGGTGG - Intronic
1140156145 16:72428692-72428714 ATGTGAGTACTTGGGGAGGGGGG + Intergenic
1140222439 16:73053746-73053768 CTGTGGCTGCCTGGGGAAGGGGG - Intronic
1141027394 16:80561114-80561136 ATGTGAGTGCCAAGGGAAGAGGG - Intergenic
1141423969 16:83933780-83933802 ATCTGAGGACCCAGGGAAGGCGG - Intronic
1141532605 16:84657212-84657234 CTGTGAGTACCTGGAGCAGGAGG + Exonic
1141578543 16:84981615-84981637 CAGCGAGTCCCTCGGGAAGGAGG + Intronic
1141614587 16:85203020-85203042 CTGTGTGTTCCTGGGGAATGTGG + Intergenic
1143624829 17:8103755-8103777 GGGTGAGTCACTAGGGAAGGAGG + Intronic
1145760877 17:27425086-27425108 TTGTGGGTACCAAGGGAAGCTGG - Intergenic
1147129727 17:38399989-38400011 CTGGGAGTTCCTGAGGAAGGGGG + Exonic
1148150882 17:45395962-45395984 CAGTGAGCACCTGGGGCAGGTGG - Exonic
1152877438 17:82794981-82795003 CTGTGTGTAGCTGGGGACGGTGG + Intronic
1152885129 17:82845130-82845152 CTGTGTGCCCCTAGGGAAAGAGG - Intronic
1153328168 18:3843120-3843142 GTGTGTGTATATAGGGAAGGTGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1154977033 18:21468360-21468382 CTGTGATTGCCTAGGGATGGGGG + Intronic
1155980186 18:32171613-32171635 AAATGAGTACCTAGTGAAGGGGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159406259 18:68006550-68006572 ATGTGTATACCTAGGGATGGGGG + Intergenic
1161668006 19:5588697-5588719 CTGTGGCTACCAAGGGCAGGGGG + Intronic
1162042709 19:7980179-7980201 CTGTGGGTATCTTGTGAAGGCGG + Intronic
1163677598 19:18663096-18663118 CTTTGAGTCCCTGGGGAAGCAGG - Intronic
1165358298 19:35317738-35317760 CTGTGGGTTCCTGGGGAATGTGG + Intergenic
1165443321 19:35843393-35843415 CTGTGAGTTCCTTGGGAGTGGGG - Intronic
1165706754 19:37981774-37981796 CCGTGAGTATTTAGGAAAGGAGG + Intronic
1166345942 19:42165835-42165857 CTGTGAGTAGTAAGTGAAGGTGG + Intronic
1166803492 19:45471728-45471750 CTGTGGGTGGCTAGGGCAGGAGG - Intronic
1167347691 19:48956380-48956402 CTGTGAGGACCTGGGGATCGTGG + Intronic
928447103 2:31342345-31342367 CTGTACGTGCATAGGGAAGGGGG - Intronic
929589693 2:43136780-43136802 CTGTGAGCACCTATAGATGGGGG - Intergenic
930309672 2:49724109-49724131 ATGTAGGTACCTAGGCAAGGAGG + Intergenic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
930936633 2:56960612-56960634 CTGTGAGTGCATGAGGAAGGAGG + Intergenic
931668590 2:64627300-64627322 CTGTGAGGCCCTAAGGAAGGAGG + Intergenic
932216482 2:69969528-69969550 CTGTGAGTATCCAGGGAGAGAGG - Intergenic
932335053 2:70925971-70925993 CTCTGAGTATCCAGGGAAGAAGG - Intronic
933672663 2:85023672-85023694 CTGTGTGCACCTAGAGAATGTGG - Intronic
934937636 2:98476881-98476903 CTGTGAGTACCCAGAGAACAGGG - Intronic
937694054 2:124788128-124788150 CTGGGAGAACCCAGGGGAGGTGG - Intronic
937953581 2:127406967-127406989 CTGTGATTACCTGGGGTGGGAGG - Intergenic
938383676 2:130850247-130850269 CTGTCTGTACCTGAGGAAGGAGG + Intronic
940220645 2:151347871-151347893 AAGTGAGTGCCGAGGGAAGGAGG + Intergenic
944992438 2:205253492-205253514 CTGGAAGTACCTGGGGAAGCAGG + Intronic
1171377630 20:24704231-24704253 CTGTGAGTACCTTTGAAAGGGGG - Intergenic
1171934107 20:31257347-31257369 CTGTGAGAATGTAGGGGAGGGGG + Intergenic
1173291966 20:41723184-41723206 TTGTAAGTAGCTAGGGAAGAGGG - Intergenic
1173394796 20:42669312-42669334 CCATGAGGATCTAGGGAAGGAGG - Intronic
1173654860 20:44692992-44693014 CTGTGAGTAGGCAGTGAAGGTGG - Intergenic
1174074699 20:47925287-47925309 CAGTGAGTACCTAGGAGAGGCGG - Intergenic
1175391906 20:58632788-58632810 CCGTGCTTACCTAGGGAAAGCGG + Intergenic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1177069785 21:16490226-16490248 CTCTGAGTGCTTATGGAAGGAGG - Intergenic
1178348420 21:31851876-31851898 ATGGGACTACCTAGGGATGGGGG - Intergenic
1182216404 22:28722178-28722200 TTGTGGGTACCTAGGGGAGGAGG - Intronic
1182785523 22:32904376-32904398 CTCTGAGTACCTAGCGATGGTGG + Intronic
949491523 3:4594161-4594183 CAGTGAGTCCCTGGTGAAGGTGG - Intronic
952672232 3:35983767-35983789 CTTTGAGAATCTAGGGAAGAAGG - Intergenic
955665956 3:61349351-61349373 GTTTGACTACCTGGGGAAGGAGG - Intergenic
956399743 3:68864936-68864958 CTGTGGTTGCCTAGGGATGGTGG + Intronic
960052662 3:113252828-113252850 CTGTGAGTGCTCAGGGAGGGAGG + Intronic
960165870 3:114400692-114400714 CTGGGGGACCCTAGGGAAGGAGG + Intronic
960432568 3:117587592-117587614 CTGTAAGTCCCCAGGGAGGGTGG - Intergenic
961000923 3:123373509-123373531 CTGTGAGACCCTATGGATGGGGG - Intronic
961514006 3:127421674-127421696 CTGTGAGTGCCCAGGGCAGGGGG + Intergenic
961701523 3:128748428-128748450 CTTTGAGTAGACAGGGAAGGTGG + Intronic
962961266 3:140313528-140313550 CTGAGAGTGCCTAGAGGAGGTGG + Intronic
963061347 3:141229675-141229697 AAGTGTGGACCTAGGGAAGGGGG + Intronic
963364575 3:144319063-144319085 CTGGTAGTACCTTTGGAAGGAGG - Intergenic
964669975 3:159214358-159214380 CAGTGAGGATCTAGAGAAGGTGG - Intronic
967538506 3:190635969-190635991 CTGTGAAAACCGAGGGAATGGGG + Intronic
972550987 4:40134309-40134331 CTATGAGTACCTAGAGCAAGAGG + Intronic
973263935 4:48192325-48192347 CAGCGATTACCTAGGGATGGTGG + Intronic
974945342 4:68520510-68520532 TTGTGAGTAAATTGGGAAGGAGG - Intergenic
974955274 4:68631928-68631950 TTGTGAGTAAATTGGGAAGGAGG - Intronic
975834457 4:78407649-78407671 CTGTGCCTTCCTAGGGGAGGTGG + Exonic
976942898 4:90728188-90728210 CTGTCAGTTCCTTGGGAATGTGG - Intronic
977804733 4:101283622-101283644 CTGACAGTTCCCAGGGAAGGAGG - Intronic
977879385 4:102186836-102186858 CTGTGAGTACAAAGGGATGGTGG + Intergenic
978669767 4:111232659-111232681 CTCTGAGAACCTGGGGAAGATGG - Intergenic
979408606 4:120345445-120345467 CTGTGAGGACCGTGGGAAGCAGG + Intergenic
981371953 4:143968829-143968851 TTATGAGGACCTAGGCAAGGAGG + Intergenic
981381044 4:144072028-144072050 TTATGAGGACCTAGGCAAGGAGG + Intergenic
981842245 4:149126014-149126036 CTGTGAATAACTAGGGAATGTGG + Intergenic
982536131 4:156608437-156608459 CTGTGTTTTCCTTGGGAAGGTGG - Intergenic
983636558 4:169903191-169903213 GTGTCAGTATCTAGGGAAAGAGG - Intergenic
985552727 5:541623-541645 CTGTGAGGAGCAGGGGAAGGTGG - Intergenic
985811498 5:2093235-2093257 CAGTGATTGCCTAGGGAGGGTGG + Intergenic
986112007 5:4728497-4728519 CTTTGATCACCTAGGGGAGGTGG + Intergenic
986116205 5:4777625-4777647 TAGTGAGGACCTATGGAAGGAGG - Intergenic
988708695 5:33752110-33752132 CTGTCAGTTTCTAGGGAAAGGGG + Intronic
996703801 5:126476377-126476399 GTGTGAGTTCCTAGGGAAGGGGG + Intronic
997311497 5:132887863-132887885 CTCTGAATACATAGGGAATGGGG + Exonic
1001101054 5:168814565-168814587 CTTTGAGGCCCTAGAGAAGGAGG - Intronic
1002640789 5:180629695-180629717 CTGGGACTACCCAGGGAAGCAGG - Exonic
1003032787 6:2616984-2617006 CAGTGATTCCCTAGGGAATGTGG + Intergenic
1003301045 6:4883196-4883218 ATGCTAGTACCTAGGGAAGTGGG + Intronic
1004394966 6:15239632-15239654 CTGTGAGTAGGCAGGGAAAGGGG - Intergenic
1004700557 6:18075462-18075484 AAATGAGTACCAAGGGAAGGGGG + Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007446353 6:41909313-41909335 CTGTGACTTCCTGGTGAAGGTGG - Exonic
1007631886 6:43277263-43277285 CTGTGAGAACCTGGGGTTGGGGG + Intronic
1011650135 6:89498317-89498339 ATGTGGCTACCTAGGTAAGGGGG + Intronic
1013055085 6:106575419-106575441 CTGTGAGAACGTAGGGACGACGG + Intronic
1015774931 6:136804469-136804491 TAGTGATTACCTGGGGAAGGAGG + Intergenic
1019318063 7:400582-400604 CTGTGAGGACATGGGGAGGGGGG + Intergenic
1020193964 7:6022693-6022715 CTGTGAGCATTTGGGGAAGGGGG + Exonic
1021996246 7:26180550-26180572 CTGTGAATACTCAGGGAAGTGGG - Intronic
1022441234 7:30435283-30435305 ATGTGAAGACCTGGGGAAGGAGG + Intronic
1024746197 7:52409115-52409137 CTGTGAGCCCCCAGGTAAGGAGG - Intergenic
1025637407 7:63335167-63335189 CTGTAAGTACCAAGGAAAGAGGG - Intergenic
1025645290 7:63412932-63412954 CTGTAAGTACCAAGGAAAGAGGG + Intergenic
1027909233 7:84227839-84227861 CTTTCAGTAGCTAGGGAAAGAGG - Intronic
1029860946 7:103571430-103571452 GTATGAGTGCCTAGGGAGGGTGG + Intronic
1032085610 7:128881908-128881930 CTGTGAGTCCCCAAGGCAGGAGG + Intronic
1032277596 7:130473158-130473180 CAGTGATTACCTGGGGATGGGGG + Intergenic
1033082207 7:138308998-138309020 GTGTAAGTATCTGGGGAAGGGGG - Intergenic
1035399086 7:158553114-158553136 GTGTGTGTACATGGGGAAGGTGG - Intronic
1037479121 8:19287707-19287729 CTGTGAGTCCCTAGAGCATGAGG - Intergenic
1039035369 8:33353619-33353641 CTGTGAGGACATGGGGAATGTGG + Intergenic
1045058637 8:98392551-98392573 CTGAGAGTTCCTAGGGCATGGGG - Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1054715975 9:68558018-68558040 CTGTGAGTACCCAGGTGAAGAGG - Intergenic
1059984726 9:119811103-119811125 CCGTGAGGTCCTAGGGAAGACGG - Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1185767448 X:2737118-2737140 TTTTCAGTACCTAGGGAAAGGGG - Intronic
1186931941 X:14403057-14403079 CTATGTTTACCTATGGAAGGGGG + Intergenic
1187107125 X:16254782-16254804 CTGTGTGTGCCTAGGGGATGGGG - Intergenic
1188316025 X:28674357-28674379 CATTGAGTGCATAGGGAAGGGGG - Intronic
1188707311 X:33351296-33351318 CAGTGGCTGCCTAGGGAAGGTGG + Intergenic
1195177399 X:102323860-102323882 CTGGGAGTACATGGGGATGGGGG + Intronic
1195181465 X:102363233-102363255 CTGGGAGTACATGGGGATGGGGG - Intronic
1195297641 X:103495511-103495533 CTGTGATTGCCTAGGGCTGGGGG - Intergenic
1196942913 X:120795376-120795398 AGGTTAGTACCTAGGCAAGGAGG - Intergenic
1199565460 X:149211156-149211178 CTGTGTTTAGTTAGGGAAGGGGG - Intergenic
1200044759 X:153395600-153395622 CTGTGGGAAACTAGGGGAGGGGG - Intergenic
1200121294 X:153792137-153792159 CAGTGATAACCTAGGGAAGGGGG - Intronic
1201374039 Y:13296644-13296666 CGGTGATGACCTAGGGTAGGGGG - Intronic