ID: 1072317940

View in Genome Browser
Species Human (GRCh38)
Location 10:94221944-94221966
Sequence AACAGCACTGGGAAGTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072317936_1072317940 -5 Left 1072317936 10:94221926-94221948 CCTTTTTCTGGACCTGGGAACAG 0: 1
1: 0
2: 1
3: 20
4: 236
Right 1072317940 10:94221944-94221966 AACAGCACTGGGAAGTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072317940 Original CRISPR AACAGCACTGGGAAGTGTTC AGG Intronic
No off target data available for this crispr