ID: 1072317993

View in Genome Browser
Species Human (GRCh38)
Location 10:94222312-94222334
Sequence GAAGCTTACCTCCTCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072317993 Original CRISPR GAAGCTTACCTCCTCTAGGG AGG (reversed) Intronic
903680743 1:25095109-25095131 GAAACTTCACTCCTCCAGGGAGG - Intergenic
905293118 1:36936684-36936706 GAAGCTTACATCCCCGTGGGAGG - Intronic
905991821 1:42344232-42344254 CAAGCTTAACTCTTCTAGTGGGG + Intergenic
906694618 1:47815594-47815616 GAAGCTCACCTCCTCCAAGAAGG + Intronic
907805804 1:57818378-57818400 GATGCTTGCCCCTTCTAGGGAGG - Intronic
909627324 1:77732364-77732386 GTAGTTTACATCATCTAGGGTGG - Intronic
914097248 1:144554387-144554409 TAAGCTTACTTCCTCAATGGAGG + Intergenic
914301745 1:146383222-146383244 TAAGCTTACTTCCTCAATGGAGG - Intergenic
914847602 1:151291600-151291622 GGAACTTTCCTCCTCTAGGCCGG + Exonic
915044430 1:153000217-153000239 GGAGCTTCCTTCCTCTGGGGAGG + Intergenic
921178767 1:212615385-212615407 GGAGCTTACCTTCTCCTGGGAGG + Intronic
921567835 1:216741507-216741529 AAAGATCACCTCCTCTCGGGAGG + Intronic
924177158 1:241402951-241402973 GAAGCTTTCCTCCCCTCTGGAGG + Intergenic
1063287956 10:4711208-4711230 GGAGTTGACTTCCTCTAGGGAGG - Intergenic
1064674489 10:17747689-17747711 AAAGCTTACCTCCTCTGAGAAGG + Intergenic
1065661932 10:28013240-28013262 GAGGCTTCCCTCCTCTTGGTTGG - Intergenic
1072317993 10:94222312-94222334 GAAGCTTACCTCCTCTAGGGAGG - Intronic
1073122247 10:101129739-101129761 GAAGCTTACATTCTATAGAGGGG - Intronic
1081541789 11:44039958-44039980 GAAACCTACCTCCCCGAGGGTGG - Intergenic
1083213258 11:61202621-61202643 GAAGTTTGCCTCCTCCAGGAAGG + Intergenic
1083216137 11:61221366-61221388 GAAGTTTGCCTCCTCCAGGAAGG + Intergenic
1083219021 11:61240192-61240214 GAAGTTTGCCTCCTCCAGGAAGG + Intergenic
1091175090 11:133550592-133550614 GAAGCTAACCTCCTGTGGGTTGG + Intergenic
1091951720 12:4598474-4598496 GAATCTTAAATTCTCTAGGGTGG - Intronic
1095685228 12:45025581-45025603 GAAGGTGAGCTCCTTTAGGGTGG - Intronic
1096088641 12:48883538-48883560 GAAGCTTCACTCGTCTAGGCTGG - Intergenic
1102046839 12:109834667-109834689 GCAGCTCACTTCCTCCAGGGTGG + Intergenic
1104762086 12:131303093-131303115 GAAGTTTACATGCTCTATGGAGG + Intergenic
1104817690 12:131657691-131657713 GAAGTTTACATGCTCTATGGAGG - Intergenic
1105846677 13:24299701-24299723 GAAGCCTTCCTCCTGTAGGCAGG - Intronic
1106813897 13:33386546-33386568 CAAGGTGACCTCCTCTGGGGGGG + Intergenic
1106872600 13:34037841-34037863 GCATCTCACCTCCTCTAGGCTGG + Intergenic
1107819606 13:44274292-44274314 GAAGCTTCACTTCACTAGGGTGG + Intergenic
1110139778 13:72114328-72114350 GCAGCTTACTTCCTCAAGGATGG + Intergenic
1125094010 15:35830030-35830052 CAACCTTCCCTCCTCCAGGGAGG + Intergenic
1128725385 15:69984077-69984099 GCAGCTTTGCTCCTCTAGGCTGG - Intergenic
1130574291 15:85077526-85077548 GAAGCTGTCTTCCTCTGGGGAGG - Intronic
1130795430 15:87203583-87203605 GAAGCCTCCTTCCTCTAGAGGGG + Intergenic
1131685407 15:94762231-94762253 GAAACTTACAGCCTCTATGGAGG + Intergenic
1143107061 17:4535210-4535232 GAAGCCAACCTCCTGTAGGTTGG + Intronic
1147242849 17:39101877-39101899 GAAGCATACCACCTCTCGGTAGG - Intronic
1148131507 17:45265083-45265105 AAAGCTTTCCTCCTGGAGGGTGG + Intronic
1153847407 18:9062504-9062526 GATGGTTACCTTCTCTATGGAGG - Intergenic
1156462325 18:37327931-37327953 GAAGCTCACCTCCTACAGGGAGG + Intronic
1159144088 18:64431012-64431034 GATGATTTCCTACTCTAGGGTGG - Intergenic
1160085497 18:75773487-75773509 GAAGCTTACATTCTGTGGGGTGG - Intergenic
1161996582 19:7716403-7716425 GTAACTTACCTTATCTAGGGTGG - Intergenic
1164477268 19:28585352-28585374 AATGCTTCTCTCCTCTAGGGTGG - Intergenic
928253017 2:29698357-29698379 GAAATGTAACTCCTCTAGGGAGG + Intronic
935863898 2:107363964-107363986 GAAGGTTACTCCCTCAAGGGTGG - Intergenic
941939088 2:171014237-171014259 GAAGCTTACATTCTAGAGGGAGG + Intronic
942815737 2:180051508-180051530 TAAGCTTAACTCCTATAGGTAGG + Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1176894846 21:14364524-14364546 GTAGCTTACATCCTTAAGGGAGG - Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1182169834 22:28216356-28216378 CAAGCTTACCTCCTCTTTGAAGG - Intronic
1182512031 22:30826596-30826618 GTAGCTTACAGCCTCTAGGAGGG - Intronic
1185329519 22:50245901-50245923 CCAGCTTACCTCCTCCAGGAGGG + Exonic
950621535 3:14209600-14209622 GAAGCTTACCTTCTAGTGGGAGG - Intergenic
951545784 3:23823508-23823530 CAACCTTTCCTCCTCTATGGGGG + Intronic
953237820 3:41121472-41121494 CTGGCTTACCTCATCTAGGGTGG - Intergenic
954436202 3:50497667-50497689 GAATCTTGACTCCTTTAGGGAGG + Intronic
955971198 3:64440298-64440320 GAAGCTTACTTTCTCTTTGGGGG + Intronic
956603378 3:71047244-71047266 AAAGCATACCTCCTCTGAGGAGG + Intronic
962261300 3:133909844-133909866 GATGTTTTCCTTCTCTAGGGAGG + Intergenic
962493679 3:135918606-135918628 GAAGCTTACCTTCCATTGGGAGG - Intergenic
968746621 4:2363821-2363843 GCCCCTTACCTCCTCTGGGGTGG - Intronic
979305713 4:119141169-119141191 GAAGCTTATTTGCTTTAGGGTGG - Intronic
995444609 5:112228843-112228865 GATGCTGACCTCCTCTGGGTGGG + Intronic
995536787 5:113144527-113144549 GAAGCTTAGCTGATTTAGGGAGG - Intronic
996690328 5:126333487-126333509 GAAGGTCTCCTCCTCTAGGTTGG - Intergenic
1000683384 5:164215522-164215544 GAAACTTACCTCCTCTAAAAGGG - Intergenic
1002162238 5:177321313-177321335 GAAGCTTTCCTCTTTTAGTGTGG + Intergenic
1003086453 6:3064667-3064689 CAAGAGAACCTCCTCTAGGGTGG + Intronic
1007219625 6:40268402-40268424 GAAGTTTACTTCCTATCGGGTGG - Intergenic
1007405489 6:41633802-41633824 GAAGCTTCCCTCCCCTGGGGAGG + Intergenic
1007628999 6:43262445-43262467 GAAGATTAGCTTCCCTAGGGTGG + Intronic
1007784227 6:44270864-44270886 GACTCTCACCTCCTCTCGGGCGG - Exonic
1008554997 6:52665406-52665428 ACAGCTTACCTTCTCTACGGGGG - Intergenic
1019744100 7:2689855-2689877 GAAGCTGACCCCCACTAAGGCGG + Intronic
1024736573 7:52311434-52311456 GAGGCTCACCTCCATTAGGGAGG + Intergenic
1037029237 8:14082800-14082822 GAAGCTTACCCTCTATGGGGAGG - Intergenic
1040517612 8:48147414-48147436 GAGGCTTTCCTCCTGTTGGGTGG + Intergenic
1040931288 8:52738096-52738118 GAGGGTAACCTCCTCTTGGGAGG - Intronic
1042556038 8:70034627-70034649 GAACCTGACAACCTCTAGGGAGG - Intergenic
1049918710 9:343673-343695 AATGCTTATCTCCTCTAGGAGGG - Intronic
1053514651 9:38720313-38720335 GAAGCTCGCCTTCTCTGGGGAGG - Intergenic
1056927034 9:90843974-90843996 GAAGATTACCTGGTCCAGGGGGG + Exonic
1061075070 9:128336188-128336210 GCAGCTCACCTGCTCTAGGCAGG + Intergenic
1189498085 X:41528020-41528042 CAGGGTTACCTCTTCTAGGGTGG + Intronic
1190324207 X:49196708-49196730 GATGTTTACCTCCTGCAGGGTGG - Intronic
1194562333 X:95438012-95438034 GAAGCTTACCTACATTATGGTGG + Intergenic
1202048457 Y:20757242-20757264 GAAGCTTACATCCTGCTGGGAGG + Intronic