ID: 1072318761

View in Genome Browser
Species Human (GRCh38)
Location 10:94228558-94228580
Sequence AGTGAGAACCCTCATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072318761_1072318764 30 Left 1072318761 10:94228558-94228580 CCATCCTCATGAGGGTTCTCACT 0: 1
1: 0
2: 0
3: 7
4: 152
Right 1072318764 10:94228611-94228633 AGATTTTTCTTTGATTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072318761 Original CRISPR AGTGAGAACCCTCATGAGGA TGG (reversed) Intronic
904774208 1:32896702-32896724 AGTGAGGAACATCAGGAGGAAGG - Intronic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
906369150 1:45237335-45237357 AGTGAGAACTCTCATCACCAAGG - Intronic
906809246 1:48809410-48809432 AGTGAGAGCCCTGAGTAGGATGG + Intronic
913061143 1:115209298-115209320 AGTGAGAATTCTCAGGATGATGG + Intergenic
917487440 1:175467754-175467776 AGAGAGGAGCCTCATGAGGGTGG - Intronic
919071977 1:192767204-192767226 AGTAAGGACCTTGATGAGGATGG + Intergenic
919274752 1:195399437-195399459 ACTGTGCAGCCTCATGAGGAAGG + Intergenic
921015660 1:211188412-211188434 AGCGAGGACATTCATGAGGAGGG - Intergenic
921300710 1:213749185-213749207 AGTGTAAATCCTCAAGAGGATGG + Intergenic
1065325031 10:24543345-24543367 AACGTGAACCCTAATGAGGATGG + Exonic
1065330119 10:24587024-24587046 AGTGAGAACCCACCCCAGGAAGG + Intronic
1065464250 10:26001971-26001993 AGTGAGACCCTTTCTGAGGAGGG + Intronic
1065749331 10:28871222-28871244 ACTGAGAACCCCCAGAAGGAGGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1068515750 10:58023283-58023305 AGTCAGGACCCTAATGAGGAAGG - Intergenic
1070649585 10:78225294-78225316 AGTGACAACCCTCAGGAAGTGGG + Intergenic
1072318761 10:94228558-94228580 AGTGAGAACCCTCATGAGGATGG - Intronic
1076285349 10:129290204-129290226 AATGAGGACCCTAAGGAGGATGG + Intergenic
1076843686 10:133058625-133058647 AGTGAGAAACGTCCTGTGGAGGG - Intergenic
1077287608 11:1774728-1774750 ACTGAGATCCCTGAGGAGGAAGG + Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079201281 11:18379466-18379488 AGTAAGAACCCTCTTCAGCATGG + Intergenic
1079249714 11:18778541-18778563 TGTGAGAACTCTCGTCAGGATGG - Intronic
1080012259 11:27471737-27471759 AGCGAGGGCCCTCATGAGAAGGG + Intronic
1081578538 11:44334879-44334901 AGAGAGAAGCTTCAAGAGGACGG - Intergenic
1081598505 11:44475716-44475738 AGTGGGCACCCTCATGAAGGGGG + Intergenic
1083713883 11:64564852-64564874 ATCGAGAACCCCCATGAGGTGGG - Intronic
1084397163 11:68919312-68919334 AGTGAGATCCCATATGGGGATGG - Intronic
1087290297 11:96313793-96313815 TATGAGGACCTTCATGAGGATGG - Intronic
1090314470 11:125772834-125772856 AGTCAGGGCCCTCATAAGGAAGG - Intergenic
1091089128 11:132753086-132753108 AGTGCAAAGCCTCCTGAGGAAGG - Intronic
1091120238 11:133051446-133051468 AGTGAGTACCCTGAACAGGAAGG - Intronic
1091146552 11:133285077-133285099 AATGAGAGACCTCATGAGGAAGG + Intronic
1091175074 11:133550453-133550475 AGAGAGGGCCTTCATGAGGAGGG + Intergenic
1092303260 12:7273088-7273110 ACTGAGCCACCTCATGAGGATGG - Intergenic
1093098084 12:14994980-14995002 TGGGAGAACCCTGATGAGGCTGG + Intergenic
1095789484 12:46148605-46148627 AATGAAAAACTTCATGAGGAAGG - Intergenic
1096872465 12:54602056-54602078 AGTGTGCACCCTCATGAGAGAGG - Intergenic
1097189122 12:57211119-57211141 ATGGAGAGCCCTCATGAGGGTGG + Intronic
1098658038 12:73057689-73057711 AGTGAGAACCCTGTTGTGAAGGG + Intergenic
1102507675 12:113394025-113394047 AGTGGGAACCCAGAAGAGGATGG + Intronic
1104781375 12:131422537-131422559 AGTGAGGACCCTAGTGGGGAAGG - Intergenic
1106698732 13:32206280-32206302 AGGGAGAACACTCAGGAGAAGGG + Intronic
1107157962 13:37191936-37191958 TGTGAGAACCTACATGAAGAAGG + Intergenic
1110671909 13:78190527-78190549 ACTGATAACCCTCAGTAGGAGGG - Intergenic
1112451856 13:99519325-99519347 AGTGAGATTCCTAAAGAGGAAGG - Intronic
1113978098 13:114247189-114247211 AGTGAGAACCCTCGAGAGAGAGG - Intronic
1115546356 14:34467989-34468011 AGAGATAACTCTCATGAGGCTGG - Intergenic
1117479215 14:56126389-56126411 AGTGAGAAGCATTATGCGGATGG - Intronic
1120157749 14:81112715-81112737 AGTGAAAAGCCTCATCAAGAAGG + Intronic
1120930333 14:89841809-89841831 AGTGAGAACCCTCAGAGGGTTGG - Intronic
1122237842 14:100342582-100342604 AGTAAGGACCCTGATGAGGGCGG + Intronic
1122862574 14:104589146-104589168 CGTGTGCACCCTCTTGAGGAGGG + Exonic
1123723847 15:23083253-23083275 AGTAAGAACCATCAACAGGAAGG + Intergenic
1125139069 15:36382462-36382484 ATTGACAACACTCATGAAGAGGG - Intergenic
1129690917 15:77712802-77712824 AGCGAGACCCCTCATCAGGCAGG - Intronic
1134133791 16:11667168-11667190 AGGGAGGGCCCTCCTGAGGAAGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1140330517 16:74052504-74052526 AGTGAAATCCCTAATGAGTAAGG + Intergenic
1140985908 16:80157772-80157794 AGAGAGAAGCCACGTGAGGAGGG - Intergenic
1150216628 17:63475126-63475148 CCTGAGAACCCTCTTCAGGAGGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152879863 17:82808627-82808649 AGAGAGAACCCTGCTGTGGAGGG + Intronic
1153385225 18:4485752-4485774 AGTGAAAACTCACATGAGGAAGG - Intergenic
1156119762 18:33828367-33828389 ATAGAGAACCCTTATGAAGAAGG - Intergenic
1157303745 18:46500913-46500935 AGAGAAAACCCTCCTGAAGAAGG - Intronic
1158014451 18:52766989-52767011 AGAGAGAATCCCCATGAAGAAGG + Intronic
1158052142 18:53234982-53235004 TTTGAAAAACCTCATGAGGATGG + Intronic
1158379027 18:56907752-56907774 AGTGAGGACTCTCAGGAAGAAGG - Intronic
1158609100 18:58922748-58922770 AGTGAGAACCCTCCTAAGCCAGG - Intronic
1159941980 18:74415252-74415274 AGTGAGCCCTCACATGAGGAGGG - Intergenic
1163205383 19:15798674-15798696 AGGGACAACCTCCATGAGGAGGG - Intergenic
1165631518 19:37305580-37305602 AGGGAGAAACTTCGTGAGGATGG - Intergenic
1167033140 19:46976899-46976921 GGTGTGAAACCTCATGAGCAAGG - Intronic
1167561931 19:50231233-50231255 AGTGGGAACCTGGATGAGGAGGG - Intronic
926796386 2:16622568-16622590 AGTGAGATCACGCATGAGCATGG - Intronic
927578376 2:24219598-24219620 TCTGGGAACCTTCATGAGGATGG + Intronic
928316377 2:30249780-30249802 AGTAAGAACCATCATTAGGAAGG + Intronic
930831644 2:55750038-55750060 AGAGAAAACCCTCATGGTGATGG + Intergenic
930877259 2:56232950-56232972 AGGCAGAACCCTCTAGAGGAAGG - Intronic
937066941 2:119024496-119024518 AGTGTGAGCCCTCTTGAGGGGGG - Intergenic
938724797 2:134097795-134097817 AGAGAGAACACTCATGAGTGAGG + Intergenic
941295965 2:163737715-163737737 TGTGAACACCCTTATGAGGAGGG - Intergenic
944542357 2:200766099-200766121 AATGAGACGACTCATGAGGAGGG - Intergenic
946031969 2:216712559-216712581 GGTGAGAAGCCTTAGGAGGATGG + Intergenic
947062203 2:226179602-226179624 AATGAGAAGCCTGATAAGGAAGG + Intergenic
948165372 2:235857226-235857248 AGTGCGAACCCTATTGAGAACGG + Intronic
1170611565 20:17917873-17917895 TGTAAGAAACCTCATGAGGGGGG - Intergenic
1170915319 20:20618432-20618454 AGTGAGAAAATTCATGAGTATGG + Intronic
1176271902 20:64239695-64239717 AGAGAGGACCCCCAGGAGGATGG + Intronic
1178111516 21:29374427-29374449 GGAGAGAACCCTTAAGAGGAAGG - Intronic
1178579958 21:33830000-33830022 AGTGAGAACTCATATGACGAGGG + Intronic
1179007313 21:37527224-37527246 GGTGAGAACCACCAAGAGGATGG + Intergenic
1179079537 21:38158133-38158155 AGTGAGAACCGTCTTCAGAAAGG - Intronic
1179461610 21:41539032-41539054 ATTCAGAACGCTCATGGGGAAGG - Intergenic
1180942686 22:19669807-19669829 AGGGACAACCCAGATGAGGAAGG + Intergenic
1182154111 22:28052987-28053009 AGGGAGAGCACTCATGTGGATGG + Intronic
950775281 3:15344508-15344530 ACTGAGAAGCCTCAGGAAGATGG + Intergenic
950904035 3:16521352-16521374 AATCAGAACCCTCATGTGGTTGG - Intergenic
953158527 3:40396716-40396738 AGGGTGAAGCCTCAAGAGGAAGG - Intronic
953411992 3:42695836-42695858 AGTGAGGTCCCTGAAGAGGAAGG - Intronic
955391382 3:58524746-58524768 AGGGGGAACCCTCAGGAGGGAGG - Intronic
955995965 3:64681220-64681242 AGAGAGAGCCCTCAACAGGAAGG - Exonic
956078726 3:65534704-65534726 AGTGAGAACACTGACGATGATGG + Intronic
957432710 3:80133374-80133396 AGTGAGTACCCTCAGGAGAGAGG - Intergenic
959988615 3:112605434-112605456 GGTGATAACTCTCATGATGACGG + Exonic
960040515 3:113145695-113145717 AGTCAGAACTCTCATGATGCTGG - Intergenic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
967638473 3:191833636-191833658 AGTGACAACCTACTTGAGGAGGG - Intergenic
968280901 3:197476039-197476061 AGTGACAACCCCCCTGAGGTTGG - Intergenic
971993288 4:33929675-33929697 AGTCAGAACCCTCATGAATGAGG - Intergenic
972860547 4:43164104-43164126 ATTGAGAACTCTCATGTTGAAGG + Intergenic
977551761 4:98450220-98450242 GCTGAGAACCCTCATGCTGATGG + Intergenic
988295602 5:29356786-29356808 AGTGAGAACGCTCTTGAGGGTGG - Intergenic
990905266 5:60796184-60796206 AGTGAGAAAACAGATGAGGAAGG - Intronic
992156929 5:73964561-73964583 AGAGAGAACCCTCTTTAAGAGGG + Intergenic
995037159 5:107547305-107547327 AGTCAGATCTCTCATGAAGATGG - Intronic
998006919 5:138663190-138663212 AGAGAGACACATCATGAGGATGG - Intronic
1002058158 5:176610313-176610335 AGTGGGAACCCGCTCGAGGACGG - Intergenic
1003338407 6:5196546-5196568 AGTGAGCACTCTTAGGAGGAAGG - Intronic
1007386645 6:41524672-41524694 GCTGAGAGCCCCCATGAGGAAGG + Intergenic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1007956613 6:45923636-45923658 GGTGAGGACCCTGATGGGGAAGG + Intronic
1010911977 6:81569722-81569744 AGTAAGAAGCCTGATGTGGAGGG - Intronic
1011282307 6:85689264-85689286 AGTGAGTACCCATATAAGGATGG - Intergenic
1019255985 7:51449-51471 ATTGAGAACCCTAATAAGTATGG + Intergenic
1024999577 7:55303826-55303848 TGTCAGAACCCTCATGTTGAGGG - Intergenic
1028614699 7:92753315-92753337 AATGCGAGCCCTCATGAGTATGG - Intronic
1029275736 7:99403272-99403294 AGTGTAAACCCTCAAGAGCAAGG + Intronic
1032513003 7:132486854-132486876 AGAGACAACCCTCCTGAGGCAGG - Intronic
1032639007 7:133743936-133743958 AGAGAGAACTCTGAGGAGGAAGG + Intronic
1033313142 7:140277009-140277031 ACTGTGTACCCTCATGGGGAAGG - Intergenic
1034427425 7:151021404-151021426 AGGAAAAACCATCATGAGGAGGG + Intronic
1036174830 8:6527419-6527441 GGTCAGAAACCTCATGAGGGAGG - Intronic
1039981661 8:42413754-42413776 GGTGAGTCCCCTCAGGAGGATGG - Intergenic
1040647410 8:49415369-49415391 CATGGGCACCCTCATGAGGATGG - Intergenic
1044531335 8:93310771-93310793 TGTGAGAAACCTCTCGAGGACGG + Intergenic
1044554426 8:93546918-93546940 ATTGGGTACACTCATGAGGATGG + Intergenic
1048379040 8:133847628-133847650 AGAAAGAACCATCATGAGGGAGG - Intergenic
1050853634 9:10322078-10322100 TGTAATAACCCTCATGCGGATGG - Intronic
1051435443 9:17026108-17026130 AGTGGAAAACCTCAAGAGGAAGG + Intergenic
1052200948 9:25779166-25779188 ACTGAGAACTAACATGAGGAGGG - Intergenic
1055107616 9:72528679-72528701 ATTCAGAACCTTCAGGAGGATGG - Intronic
1056547761 9:87627208-87627230 AGAGAGGACCCTCAGGAGCAAGG - Intronic
1056783608 9:89571615-89571637 AGTGAGAAAACTCAAGAGAAAGG + Intergenic
1057913124 9:99035436-99035458 TGTGACAACCCTCATAATGAAGG - Intronic
1059982721 9:119790863-119790885 AGTTCCAACCCTCAGGAGGAAGG + Intergenic
1060941808 9:127546792-127546814 AGAGAGTACCCTAATGAGGGAGG + Intronic
1185545179 X:937881-937903 AGTGAGACCCCATATGAGGTGGG + Intergenic
1186470154 X:9814765-9814787 AGGGAGAACCCTGATGAAGCTGG - Intronic
1188628498 X:32318947-32318969 AGTCAGAATCCACATGAGGCAGG - Intronic
1190321462 X:49182305-49182327 AGTGAGGAACCTGATGATGATGG - Intronic
1194940482 X:100003598-100003620 AGGGAGGACCATAATGAGGATGG - Intergenic
1196874266 X:120143683-120143705 AGTGTGCTCCCTCATGAGAAAGG - Intergenic
1197203190 X:123766834-123766856 AGTGAGAGCCTTCATGAAGTGGG - Intergenic
1197537268 X:127706578-127706600 CGTGAGAACCCTAATGAAGCTGG + Intergenic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1197963235 X:132028620-132028642 AGTGAGGGCCCTCATGAGACAGG + Intergenic
1199435360 X:147806215-147806237 CATGAGATCCCTCATGAGGTGGG + Intergenic