ID: 1072322938

View in Genome Browser
Species Human (GRCh38)
Location 10:94268745-94268767
Sequence CAATTAATCCAGAGTGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072322938 Original CRISPR CAATTAATCCAGAGTGGGGA AGG (reversed) Intronic
904488651 1:30844467-30844489 CCACTTATCCAGTGTGGGGAAGG - Intergenic
904545841 1:31270949-31270971 CAATGCTTTCAGAGTGGGGAGGG + Intronic
905606776 1:39307860-39307882 GAAATAATCCAGACTGGGCAAGG - Intronic
906258540 1:44368714-44368736 CAATTCATCCTGACAGGGGAGGG + Intergenic
906356547 1:45111288-45111310 CAACTAATCCAGACTGAAGAGGG + Intronic
907228939 1:52976891-52976913 GAAGTGACCCAGAGTGGGGACGG - Intronic
908945906 1:69496607-69496629 CAATCAAGCCAGAGGGTGGATGG + Intergenic
911036310 1:93552761-93552783 CAATTAAAACAGAGCTGGGAGGG - Exonic
912702708 1:111890030-111890052 CAATGACTCCAGAGTGGCCATGG + Intronic
913249965 1:116905308-116905330 AAATGCATCCAGAGTAGGGAGGG - Intergenic
913672090 1:121106480-121106502 CAAATAATTTATAGTGGGGAGGG - Intergenic
913990622 1:143608377-143608399 CCACTCATCCAGAGTGAGGAGGG + Intergenic
914023856 1:143893838-143893860 CAAATAATTTATAGTGGGGAGGG - Intergenic
914662344 1:149801876-149801898 CAAATAATTTATAGTGGGGAGGG - Intronic
915882353 1:159685335-159685357 CACCTAATCTAGAGTTGGGAGGG - Intergenic
916745347 1:167680839-167680861 CATTTAATCCAGAGAGGCTAAGG + Intronic
919663868 1:200273700-200273722 AAATTAATCCAATGTGAGGAAGG - Intergenic
920796962 1:209148117-209148139 CAGTTGAACCAGAGTGGGCATGG - Intergenic
920861886 1:209715704-209715726 AAATAAATCAAGAGAGGGGAAGG + Intronic
921724593 1:218509414-218509436 CAATTATGCCAGACTGGGGCAGG - Intergenic
922376858 1:224977524-224977546 CAATAAATCAAGAGGAGGGAAGG + Intronic
922754254 1:228086038-228086060 CAATTTTCCCAGAGTGGAGAGGG + Intronic
923254387 1:232208547-232208569 CCATAAATCAATAGTGGGGACGG + Intergenic
923816799 1:237389288-237389310 CAATTATTCCAGAGTGATTAGGG + Intronic
1063860382 10:10300787-10300809 CAATGAATTCAGTGTGGGGTTGG - Intergenic
1064963882 10:20995810-20995832 TAATTATTTCTGAGTGGGGAAGG + Intronic
1065597437 10:27328548-27328570 CATTTAATCCAGATGGGAGATGG - Intergenic
1066507760 10:36063224-36063246 CACTTAATCCAGACGTGGGAAGG - Intergenic
1067262193 10:44703832-44703854 CAATTAATCCTGAGAGGACATGG + Intergenic
1071661576 10:87507881-87507903 AAAGTAATACAGAGTTGGGAAGG + Intronic
1072322938 10:94268745-94268767 CAATTAATCCAGAGTGGGGAAGG - Intronic
1072814082 10:98487752-98487774 GAATTATCCCAGAGTGGGCATGG - Intronic
1075685024 10:124357773-124357795 CCATTCATCCAGGGTAGGGAAGG - Intergenic
1075841022 10:125503484-125503506 GAATTAGTCCACAGTGTGGATGG - Intergenic
1077998489 11:7474344-7474366 CAATTTATCCAATGTGAGGATGG + Intergenic
1078276070 11:9848075-9848097 CTAGTAAGCCAGGGTGGGGAGGG + Intronic
1078337230 11:10474050-10474072 CACTTAATCCAGACTAGGGGTGG - Intronic
1081756249 11:45546863-45546885 TAAATTATCCAGGGTGGGGAGGG - Intergenic
1082735060 11:56846124-56846146 CAAATCTTCCACAGTGGGGAAGG - Intergenic
1084266528 11:68008136-68008158 CACCCAACCCAGAGTGGGGAGGG + Intergenic
1085166824 11:74409135-74409157 CACTTAATCCAGACTGGGAGGGG + Intergenic
1086077669 11:82871804-82871826 TAATTAATCCAGTGTGAGCAGGG - Intronic
1087433169 11:98079488-98079510 CAATTGATCTAGATTGGTGAAGG - Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089333385 11:117705780-117705802 CAAGTGTTCCATAGTGGGGAAGG + Intronic
1095349949 12:41198258-41198280 CCATAACTCCAGAGTGGGAAAGG + Intronic
1100161296 12:91864172-91864194 CAATAAAGCCAGAGTGAGGCTGG - Intergenic
1107774916 13:43828436-43828458 CAATTAATCCCAACTGGGGAAGG - Intronic
1108418666 13:50227036-50227058 CAGTTACTCCAGCTTGGGGAGGG + Intronic
1108527349 13:51297101-51297123 CCTTTAATCCAAAGTGGGTATGG - Intergenic
1109285478 13:60404064-60404086 CAGTTAACCCAGACTTGGGAAGG + Intronic
1110045771 13:70828731-70828753 CAAGTTATCCAGAGTTGGGAAGG + Intergenic
1112421493 13:99254342-99254364 GAATGAATTCAGAGTAGGGAAGG + Intronic
1112436051 13:99392134-99392156 CAAATAATCAAAAGAGGGGAGGG - Intergenic
1113210238 13:107970068-107970090 AAATTTATCCAGATTGGGGCGGG - Intergenic
1113404292 13:110023605-110023627 CAATAATTCCATGGTGGGGAGGG - Intergenic
1117027884 14:51640147-51640169 CATCTAATTCAGATTGGGGAAGG - Intronic
1118286049 14:64474174-64474196 CAATTAATTTGGTGTGGGGAAGG + Exonic
1120261878 14:82196073-82196095 CAATTAAACCTTAGTGGGCATGG - Intergenic
1121341589 14:93108170-93108192 CAATTCATGCAGGATGGGGAAGG + Intronic
1121791501 14:96702869-96702891 AAAATAAGCCAGAGTGGGGGCGG + Intergenic
1125343312 15:38695672-38695694 CAAGTAATCCAGAGCTGGGATGG + Intergenic
1127072098 15:55297048-55297070 AAATGCATCCAGAGAGGGGAGGG + Intronic
1128718779 15:69930152-69930174 CATTGAATACAGAGTTGGGAGGG + Intergenic
1129141369 15:73601163-73601185 CAGTTAATCCTGAGTGGGGCTGG + Intronic
1129523376 15:76199484-76199506 CAATGAGTACAGGGTGGGGAAGG + Intronic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1131072956 15:89477393-89477415 CAATTGGTCCAGAGTGGGGAAGG + Intronic
1131450873 15:92538699-92538721 CAACTAACCCAGACTTGGGATGG - Intergenic
1132314127 15:100878655-100878677 CAAGTAATCAACAATGGGGAGGG - Intronic
1132941670 16:2511586-2511608 TGAGTAATACAGAGTGGGGAGGG + Intronic
1133341400 16:5038736-5038758 CAATTTAACCAGATTGGGGGTGG + Intronic
1134191718 16:12126554-12126576 CATATAATCCAGAGAGGTGAGGG + Intronic
1134327574 16:13220989-13221011 CTATTAATCCAGAGTGAGGAGGG - Intronic
1136596725 16:31255751-31255773 GATTTTATCAAGAGTGGGGATGG + Intergenic
1140957838 16:79883270-79883292 CATTTAATTGAGAGTTGGGAAGG - Intergenic
1141283119 16:82646800-82646822 CAATTAAGCCAGAGAGAGGAAGG + Intronic
1141340306 16:83197537-83197559 CATTTAATTGAGGGTGGGGAGGG - Intronic
1143585974 17:7850572-7850594 CAAATAACTCAGTGTGGGGAAGG - Intronic
1148582947 17:48756063-48756085 CAAAGACTCCAGAGTGGGGGTGG - Intergenic
1149228536 17:54504464-54504486 CAATTTCTTCAGATTGGGGATGG + Intergenic
1154376741 18:13817128-13817150 CACTCCACCCAGAGTGGGGAGGG - Intergenic
1155729220 18:29131139-29131161 AAATAAATTCAGAGTGGGCATGG - Intergenic
1157012614 18:43669605-43669627 AAATTAATTCAGAATGAGGAAGG + Intergenic
1158480288 18:57815809-57815831 AAATAAGTCCAGAGTGGGGGTGG - Intergenic
1158643084 18:59219927-59219949 GAATTAATCCGATGTGGGGAAGG + Intergenic
1159052964 18:63438605-63438627 CAATTAAACCAGGGAGGTGAAGG - Intergenic
1159250899 18:65875133-65875155 CAATTCTTCCAGTGTGGGCAGGG + Intronic
925334398 2:3083094-3083116 CAACAAACCCTGAGTGGGGAGGG + Intergenic
926853798 2:17230191-17230213 CTATCATTGCAGAGTGGGGAAGG - Intergenic
927764405 2:25791944-25791966 CAAATAATACAGACTGGAGAAGG + Intronic
929733977 2:44525999-44526021 TTCTTAATCCAGAGAGGGGAGGG - Intronic
929898602 2:45982817-45982839 CAAGAAATCCAGTGTGGGGGTGG - Intronic
930679731 2:54243982-54244004 CTACTAACTCAGAGTGGGGAAGG - Intronic
932337976 2:70941911-70941933 CACTGAAGCCAGAGTGGAGAAGG + Exonic
933700819 2:85254257-85254279 CAATTAATTCAGACTTGGGGTGG + Intronic
937538478 2:122920537-122920559 CAAGTTATCAAGAGTGGGGTGGG - Intergenic
938711884 2:133982108-133982130 CAATTAATTAAGAATGTGGAGGG - Intergenic
940176089 2:150878939-150878961 CCATATATGCAGAGTGGGGAGGG + Intergenic
941692073 2:168511101-168511123 CAATTACTCCAGATTGGGACAGG - Intronic
943436955 2:187876724-187876746 CATTGAACCCAGAGTTGGGAAGG - Intergenic
948013618 2:234670243-234670265 CATTCAATACATAGTGGGGAGGG - Intergenic
948220779 2:236268011-236268033 CAGCTGACCCAGAGTGGGGAGGG - Intergenic
1172510807 20:35499684-35499706 CAATTCATCCTGATTTGGGAAGG + Intronic
1173435965 20:43032535-43032557 TAATTAATCCAGAAGGGAGAAGG + Intronic
1177177151 21:17712505-17712527 CAATTGATCTATATTGGGGAGGG - Intergenic
1177948142 21:27498971-27498993 CATTTATTCTATAGTGGGGAAGG - Intergenic
1178694112 21:34778534-34778556 CAAGCAATCCAGGGTTGGGATGG + Intergenic
1180235118 21:46454220-46454242 CAATTATCCCAGAGCGGGAATGG - Intergenic
1182902078 22:33906843-33906865 CAATTACTCTAAGGTGGGGAAGG + Intronic
1183507249 22:38215911-38215933 CAATAAATAAACAGTGGGGAGGG - Exonic
1183622170 22:38980932-38980954 CAGTTAAGGCACAGTGGGGAAGG - Intronic
1183627066 22:39010908-39010930 CAGTTAAGGCACAGTGGGGAAGG - Intergenic
1184026023 22:41857165-41857187 AAATTAAGGCAGAGTGTGGACGG + Intronic
953673845 3:44984923-44984945 AAACTAATCCAGAGAGGGAAGGG + Intronic
954029730 3:47810472-47810494 CAATTACTCTAGAGTGGAGCTGG + Intronic
954892293 3:53942033-53942055 CAATTAAGTATGAGTGGGGAGGG - Intergenic
955506660 3:59639520-59639542 CAGCTTATCCAGAGTGGGTATGG - Intergenic
956978695 3:74612783-74612805 CAAATAATAAAGAGTGGGGTTGG - Intergenic
957041190 3:75336810-75336832 CCAGTAATCCAGAGAGGGCAGGG + Intergenic
957585472 3:82126747-82126769 CAATTAATCAGGAGTTTGGAAGG + Intergenic
959121065 3:102232882-102232904 TTATTAACCCAGAATGGGGAGGG - Intronic
960432225 3:117583080-117583102 CATTAAAATCAGAGTGGGGAAGG - Intergenic
962200020 3:133393242-133393264 TAATTAATACAGAGTGGTAAGGG - Intronic
967297840 3:187982791-187982813 CAATTGGTCCAGAGCAGGGAAGG - Intergenic
970511065 4:16782231-16782253 CAAGGAATTCAGAGTGGAGATGG - Intronic
974325288 4:60406373-60406395 CCAAGAAGCCAGAGTGGGGAAGG - Intergenic
979134900 4:117098560-117098582 CTATAAATCCAGACTGTGGATGG + Intergenic
979839891 4:125424450-125424472 CAATTAACCCAGAGCTGGGGAGG - Intronic
981533702 4:145777495-145777517 AAATTGACCCAAAGTGGGGAGGG - Intronic
981892282 4:149752654-149752676 AAATTAATACAGAGGGGTGATGG + Intergenic
985019607 4:185673793-185673815 CATTGATTCCATAGTGGGGAAGG - Intronic
989264324 5:39455555-39455577 CAATAAATCCAGAGATTGGATGG + Intronic
991480816 5:67077295-67077317 CAATTAAATCAGAATGGGGAGGG - Intronic
996546320 5:124682545-124682567 CAATCAGTCCAGATTGGAGAAGG + Intronic
998444892 5:142191100-142191122 TTATTAAGCCAGAGTGGGCATGG - Intergenic
999001157 5:147924365-147924387 CTATTCATCCAGAATGGAGAAGG + Intergenic
999474171 5:151883095-151883117 AAATTAATCCAAAGTAGGGCAGG - Intronic
1001463213 5:171937358-171937380 CAAATACTCCAGAGTAGGGTTGG + Intronic
1001629071 5:173161102-173161124 AAAATAATCCAGATGGGGGATGG - Intronic
1006604051 6:35243768-35243790 CAAACAATACAGAGTGGGGTAGG + Intronic
1006792173 6:36709845-36709867 CAATTAATACAGGCTGGGCATGG - Intronic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1007905752 6:45458998-45459020 AAATTAATCAGGAGAGGGGAAGG - Intronic
1010909078 6:81530841-81530863 CAATTGTTTCAGACTGGGGAGGG + Intronic
1011484978 6:87831560-87831582 AAAGTAAAACAGAGTGGGGAAGG + Intergenic
1013069271 6:106713887-106713909 CAGTCAATCCTGAGTGGAGAGGG - Intergenic
1018435758 6:163757516-163757538 CAATGAAGCCAGTGTGGAGAAGG - Intergenic
1023299979 7:38759702-38759724 CAGTTAGTCCAGAATGGGGATGG - Intronic
1024783430 7:52878234-52878256 CAGACAATACAGAGTGGGGAAGG + Intergenic
1027622117 7:80501271-80501293 CAAATAATTCAGAAAGGGGAAGG - Intronic
1030139916 7:106293749-106293771 CAATTTTTCCACAGTGGGCAGGG - Intergenic
1030749780 7:113217333-113217355 CAATTAATCCAGAGTCTGAGAGG + Intergenic
1031420300 7:121543594-121543616 CAGTTATTGCACAGTGGGGAAGG - Intergenic
1031993939 7:128216231-128216253 CAGTTAAGCGAGAGTAGGGAGGG + Intergenic
1032666345 7:134040463-134040485 CAATTATTCCAGAGGAGGGGTGG - Intronic
1032855825 7:135832714-135832736 CATTTAAGGCTGAGTGGGGAGGG + Intergenic
1033591813 7:142815074-142815096 TATTTAGTCCTGAGTGGGGATGG + Intergenic
1033941433 7:146659846-146659868 CAAGAACTCCATAGTGGGGAGGG + Intronic
1034103454 7:148470967-148470989 CACCTAATCTAGAGTGGGAAGGG - Intergenic
1036510260 8:9393405-9393427 CAATTAAGACACAGTGGGGATGG + Intergenic
1037221962 8:16534601-16534623 CAACTCATCAAAAGTGGGGAGGG + Intronic
1040005927 8:42620940-42620962 CACTGAACCCATAGTGGGGATGG + Intergenic
1042938370 8:74083054-74083076 AAATTAATCCAGCAGGGGGACGG - Intergenic
1043372701 8:79612234-79612256 CAATGAGGCCAGCGTGGGGAGGG - Intronic
1043940657 8:86191941-86191963 CAATTGAGCCAGAGTAGGGCAGG + Intergenic
1044561869 8:93620130-93620152 TTATTAATCCAGGGTGGGGAGGG - Intergenic
1044706523 8:95014206-95014228 CAACTAATACAGAGAGGGAAAGG + Intronic
1047987996 8:130256429-130256451 GAATGAATTCAGAGTGGTGATGG - Intronic
1053087236 9:35235991-35236013 CAATTAAACCTCAGTGGGGAGGG - Intronic
1053195261 9:36112670-36112692 CAGTTAATGCAGCCTGGGGAAGG + Intronic
1054353014 9:64035513-64035535 CAATTAATCCAGGCTGGGTGCGG + Intergenic
1055634526 9:78262414-78262436 CAATTCCTCCAGAGTGTTGAGGG - Intronic
1057405514 9:94766998-94767020 AAATTAATTCAGTGGGGGGAGGG - Intronic
1059684865 9:116625448-116625470 CAATGGGGCCAGAGTGGGGAGGG - Intronic
1060630105 9:125149446-125149468 AAATGAGTCCAGGGTGGGGATGG + Exonic
1060984611 9:127812917-127812939 CAATGAGGCCAGAGTGGGGAAGG + Intronic
1061423551 9:130485177-130485199 CCATCAGTCCAGAGAGGGGAGGG - Intronic
1062039647 9:134398321-134398343 CACTTAATCAGGGGTGGGGACGG + Intronic
1186801992 X:13102478-13102500 CAGTTAAGTAAGAGTGGGGATGG + Intergenic
1191979410 X:66909471-66909493 CATATGATGCAGAGTGGGGAGGG + Intergenic
1191985346 X:66973986-66974008 CATTTAAAGCAGAGTGGAGAGGG + Intergenic
1192020334 X:67384476-67384498 CAGCTAATGCGGAGTGGGGAAGG - Intergenic
1194463915 X:94208228-94208250 CAATGATACGAGAGTGGGGAAGG + Intergenic
1195867712 X:109451151-109451173 CAATTATTCCAGTATGGAGAGGG + Intronic
1196212661 X:113012825-113012847 CAATTAAGTCAGAATGGGCAGGG - Intergenic
1197276285 X:124483250-124483272 CAAATAACCCAGACTGGAGAAGG - Intronic
1197788139 X:130221504-130221526 TCATTCATCCCGAGTGGGGAAGG + Intronic
1198561683 X:137857171-137857193 CAATAAATCCAGGCTGGGAAGGG + Intergenic
1199384037 X:147203277-147203299 CATTTAAACCAGTGTGGAGAGGG + Intergenic