ID: 1072324620

View in Genome Browser
Species Human (GRCh38)
Location 10:94285745-94285767
Sequence CACATTCTCCACTCTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072324613_1072324620 28 Left 1072324613 10:94285694-94285716 CCAATCACTGTGGCCAGGAGATG 0: 1
1: 3
2: 15
3: 72
4: 358
Right 1072324620 10:94285745-94285767 CACATTCTCCACTCTGAGCTGGG No data
1072324614_1072324620 15 Left 1072324614 10:94285707-94285729 CCAGGAGATGCAGTGCTCTGATG No data
Right 1072324620 10:94285745-94285767 CACATTCTCCACTCTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072324620 Original CRISPR CACATTCTCCACTCTGAGCT GGG Intronic
No off target data available for this crispr