ID: 1072327378

View in Genome Browser
Species Human (GRCh38)
Location 10:94311732-94311754
Sequence TAGATGAGGACAGACAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072327378_1072327385 27 Left 1072327378 10:94311732-94311754 CCACCTCTGTCTGTCCTCATCTA 0: 1
1: 0
2: 4
3: 27
4: 388
Right 1072327385 10:94311782-94311804 ATGATCATGTCACTCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072327378 Original CRISPR TAGATGAGGACAGACAGAGG TGG (reversed) Intronic
900235242 1:1586204-1586226 TCGAAGAGGACAGCCAGAAGAGG + Intergenic
900558171 1:3290375-3290397 TAGATGAGGAGGCACAGAGAGGG + Intronic
900726413 1:4219228-4219250 GAGAGGAGGACAGAGAGGGGAGG - Intergenic
900909597 1:5585623-5585645 TGGAGGAAGACTGACAGAGGGGG + Intergenic
901037160 1:6343281-6343303 TACATGAGGACTCACTGAGGTGG + Intronic
901156982 1:7146673-7146695 TTGATGTGGGCAGTCAGAGGGGG + Intronic
901427396 1:9191173-9191195 AAGATGAGCACAGGCAGAGGCGG - Intergenic
901733125 1:11294835-11294857 CGAATGAGGACAGACAGATGAGG - Intronic
903058143 1:20650915-20650937 TAGATGAGGCTGGACTGAGGAGG + Exonic
904359514 1:29962850-29962872 CAGATGAGAGCAGACAGTGGTGG - Intergenic
905210047 1:36367712-36367734 GACATGAGGACAGACTGAGCTGG - Intronic
906511884 1:46414671-46414693 TAGGTGAGGACAGATCAAGGTGG + Intergenic
906725261 1:48039898-48039920 CAGATGAGGAAAGCCAGTGGGGG + Intergenic
906733945 1:48106418-48106440 TAGAGGAGAACAAACAGAGAAGG - Intergenic
907111283 1:51928697-51928719 GAGATGAGGATGGACAGATGGGG - Intronic
907774291 1:57498311-57498333 TAGATGTGGAAAGTCTGAGGAGG + Intronic
908391442 1:63687085-63687107 AATATTTGGACAGACAGAGGAGG - Intergenic
908914705 1:69112865-69112887 AAGAGGAGGAAAGCCAGAGGGGG + Intergenic
910378117 1:86595401-86595423 CAGATGAGGACAGGAAGATGAGG - Intergenic
911005232 1:93213959-93213981 TACATGAGAACACACAGATGTGG - Intronic
911576599 1:99585621-99585643 TAGCTGTGGACCCACAGAGGTGG + Intergenic
911601038 1:99848752-99848774 GAGATTAGGACAGACAGATGGGG - Intergenic
912012358 1:104983153-104983175 AAGATTATGACAGACACAGGTGG - Intergenic
912470932 1:109906307-109906329 TAGATGACTACAGACAGTGTAGG + Intergenic
912575376 1:110666339-110666361 GAGGTGAGGAGAGAAAGAGGAGG + Intergenic
915066730 1:153231218-153231240 TTGATGAGGACAGCCTGAGTGGG + Intergenic
916435481 1:164774036-164774058 TAGATGAGGAACTTCAGAGGGGG + Intronic
916901024 1:169224041-169224063 TAGATGATGACAGATATGGGAGG - Intronic
919825815 1:201502397-201502419 CAGCTGAGGGCAGAGAGAGGAGG + Intronic
922226460 1:223650087-223650109 TAGATCAAGAGAGAGAGAGGAGG + Intronic
922443929 1:225680240-225680262 CAGGTGAGGAGAGAAAGAGGAGG - Intergenic
923445415 1:234066349-234066371 TAGATGAGGCCAGAGAGGTGGGG - Intronic
923984396 1:239364689-239364711 TAGATGAGTACAGATATAGGAGG + Intergenic
924500591 1:244634737-244634759 TAGATGAGGAAACTCAGATGAGG - Intronic
924500913 1:244637237-244637259 GTGATGAGGACAGACAGCTGGGG - Intronic
1063283724 10:4660628-4660650 AAGATGGGGAGAGACAGAGAGGG - Intergenic
1063300576 10:4845871-4845893 TGGCTGAGGACAGACAGCAGCGG + Intronic
1064272589 10:13878904-13878926 TAAATCAGGACAGACAGATGAGG + Intronic
1064983709 10:21189254-21189276 AAGAGGAGGAGACACAGAGGAGG + Intergenic
1065241418 10:23708826-23708848 TTAATGGGGCCAGACAGAGGTGG + Intronic
1065928730 10:30459538-30459560 TTGATGTGGACAGAAAGAGAAGG - Intronic
1066106351 10:32160689-32160711 TAGATGAGGAGTGACTGAGGAGG + Intergenic
1066398322 10:35048944-35048966 TTGATGAGCACAGATATAGGTGG + Intronic
1067992033 10:51225209-51225231 CACATGAGGACACAGAGAGGAGG - Intronic
1069709796 10:70480897-70480919 TACTTGAGGACAGACACAGGAGG + Intronic
1069837025 10:71315723-71315745 TACATGAGGAGAAAAAGAGGAGG - Intergenic
1070786667 10:79166061-79166083 GAGATGAGGACAGACAGCCACGG - Intronic
1071807835 10:89143514-89143536 TAGAGCAGGAAAGACAGATGAGG - Intergenic
1072043122 10:91628191-91628213 TAGATGAGGACAGTCAGGGTAGG + Intergenic
1072327378 10:94311732-94311754 TAGATGAGGACAGACAGAGGTGG - Intronic
1072550681 10:96474943-96474965 AAGAAGAGGACAGACAGAGAAGG - Intronic
1072718002 10:97764463-97764485 AAGAACAGGACAGACAGGGGAGG - Intergenic
1073163367 10:101420782-101420804 TAGGTGAGTACAGGCAAAGGAGG - Intronic
1073443296 10:103565313-103565335 GAGCTGAGTACAGACAGAAGGGG + Intronic
1073649360 10:105342193-105342215 TAGCTGAATACTGACAGAGGAGG + Intergenic
1074327690 10:112468688-112468710 AAGATGATAACACACAGAGGAGG - Intronic
1074403931 10:113164714-113164736 TAGAAGAGGATAAACAAAGGTGG - Intronic
1075187455 10:120275901-120275923 TAGATGAGGACAGGGAATGGAGG + Intergenic
1075656112 10:124162322-124162344 AAGATGGGGACAGAGTGAGGAGG + Intergenic
1075703321 10:124483387-124483409 TAGCTGTGGACATTCAGAGGTGG + Intronic
1076811319 10:132888052-132888074 GAGAAGAGGAGAGAGAGAGGAGG - Intronic
1077006492 11:360284-360306 GAGATGGGGAGAGACAGAGAGGG + Intergenic
1077212406 11:1377619-1377641 GAGATGAGGTCAGAGAGATGGGG + Intergenic
1078006769 11:7538021-7538043 TAGGTGAGAAGAGTCAGAGGAGG + Intronic
1078020113 11:7649981-7650003 GAGAAGAGAAGAGACAGAGGAGG + Intronic
1079925081 11:26483810-26483832 CAGAAGAGGACAGAAAGATGAGG + Intronic
1080173132 11:29330238-29330260 TTTATGAGGAAAGACAGAAGAGG - Intergenic
1080207016 11:29741540-29741562 TAGAAGAGGAGAGATGGAGGAGG + Intergenic
1080798591 11:35588785-35588807 TATATGGAGACAGAGAGAGGGGG - Intergenic
1081121861 11:39276579-39276601 CATATGAGAACAGACACAGGGGG - Intergenic
1081734800 11:45395188-45395210 TGGAGGAGGAAAGACAGAGACGG - Intergenic
1082229506 11:49745891-49745913 CAGAAGAGGACAGAAAGATGTGG - Intergenic
1083896233 11:65621101-65621123 AAGATCAGGACAGACACAGTAGG - Intronic
1086284667 11:85233186-85233208 TAGCTGGGGACAGAAATAGGTGG - Intronic
1086620574 11:88883231-88883253 CAGAAGAGGACAGAAAGATGTGG + Intronic
1087838072 11:102894697-102894719 CAGAAGAGGACAGAAAGATGTGG - Intergenic
1088647030 11:111925835-111925857 GAGCAAAGGACAGACAGAGGAGG - Intronic
1090781053 11:130006985-130007007 TGGATCTGGAAAGACAGAGGTGG + Intergenic
1092913609 12:13169828-13169850 GAGATGAAGACAAACAGATGAGG + Intergenic
1093172883 12:15878909-15878931 CAGATGAGGACAGAGTGAGAAGG - Intronic
1093357315 12:18181795-18181817 TAGATGGAGACAGAGAGAAGGGG + Intronic
1093484908 12:19641915-19641937 GAGATGAGGTCAGAAAGAAGAGG - Intronic
1094058985 12:26293470-26293492 AAGATGTGGCCAGACAGTGGGGG - Intronic
1094177892 12:27560444-27560466 TTGTTGAGGACAGACTGAAGAGG + Intronic
1094245055 12:28281050-28281072 TAAATGAAGACATACAGAGATGG - Intronic
1094487570 12:30937183-30937205 TGGAGGAGGTCAGACAGTGGTGG + Intronic
1098348262 12:69528990-69529012 TAGATGAGGTAAGAGAGATGGGG + Intronic
1099177325 12:79437021-79437043 TAGATGAGGAAAGAGAGAAAGGG + Intronic
1099731276 12:86506838-86506860 TAGATGAAGGCAGAAAGAAGGGG + Intronic
1100402824 12:94246999-94247021 TACAGAAGGACAGGCAGAGGAGG - Intronic
1101041228 12:100757862-100757884 TGGATGAAGACCCACAGAGGAGG - Intronic
1101404568 12:104416564-104416586 AAAATGAGGAGAGACAGAGGAGG + Intergenic
1102518185 12:113463893-113463915 GAGATGGAGAGAGACAGAGGCGG + Intronic
1102648741 12:114421386-114421408 AGGATGAGGACAGAAGGAGGAGG + Intergenic
1103923370 12:124410895-124410917 TGGGAGAGGACAGACGGAGGAGG + Intronic
1104079945 12:125421117-125421139 TAGAAGAGGACAGGAAGATGTGG - Intronic
1104418454 12:128615170-128615192 CAGAGGAGGACAAGCAGAGGGGG + Intronic
1104469740 12:129019946-129019968 TAGGTGAGGACACAGAGAGAAGG - Intergenic
1104503619 12:129310041-129310063 TAGATGAGGGCTGGCCGAGGAGG + Intronic
1104505571 12:129328880-129328902 TGGATGAGGCCACACAGAGTTGG - Intronic
1104927667 12:132322006-132322028 AAGACGAGGAGAGACAGTGGGGG - Intronic
1105745306 13:23372714-23372736 GAGATAAGCACATACAGAGGGGG - Intronic
1106075822 13:26460028-26460050 ACAAAGAGGACAGACAGAGGAGG - Intergenic
1106210781 13:27642500-27642522 AAGAAGAGGAAAGACAAAGGAGG - Intronic
1106883669 13:34159445-34159467 GCTATGAGGACAGAGAGAGGAGG + Intergenic
1106916453 13:34520800-34520822 TAGAGGAGGCCAGAGAGTGGAGG - Intergenic
1107708761 13:43132356-43132378 GAGGTGAGGAAAGAAAGAGGAGG - Intergenic
1108542618 13:51457583-51457605 GAAATGAGGACATACATAGGCGG + Intergenic
1108729648 13:53221148-53221170 TATATGAGGACACAGAGAGAAGG - Intergenic
1109183806 13:59246110-59246132 AAAATGAGGAAAGCCAGAGGAGG + Intergenic
1110292178 13:73819973-73819995 TGGATGAGGACAGAGAGAGGAGG + Intronic
1110730490 13:78874610-78874632 AAGATGAAGGCAGACAGTGGGGG + Intergenic
1110893019 13:80713705-80713727 TAGAAGAAGACAGAAAGATGTGG - Intergenic
1113252676 13:108471705-108471727 CAGAAGAAGACAGACAGACGTGG + Intergenic
1114537912 14:23434504-23434526 TAGATGGGTACAGGCAGGGGTGG - Intronic
1114596549 14:23917225-23917247 CAGATGAGGCCAGACAGGAGAGG + Intergenic
1115269551 14:31536609-31536631 TATTTGAGGAGAAACAGAGGTGG + Intronic
1117006822 14:51428936-51428958 GAGAAGGGGAGAGACAGAGGGGG + Intergenic
1118270132 14:64335568-64335590 TAGATGAGGTCACGCAGATGGGG - Intronic
1118495863 14:66307699-66307721 CACATGAGGACACAGAGAGGAGG - Intergenic
1119634647 14:76264116-76264138 TGGCTAAGGACAGGCAGAGGAGG + Intergenic
1120824304 14:88941605-88941627 TAAATGGTGACAGACAGAGCTGG + Intergenic
1120972009 14:90215430-90215452 CAGATGAGGGCAGAAAGATGTGG - Intergenic
1121458094 14:94051993-94052015 TTCCTGAGGACAGACTGAGGTGG - Intronic
1121720874 14:96107877-96107899 TAAAAGAGGACAGAGAGGGGAGG - Intergenic
1122011694 14:98754566-98754588 TAGATGAGGACACCAAGAGCTGG - Intergenic
1122235219 14:100327460-100327482 TTGATGAGGGCAGACACTGGAGG + Intronic
1122448215 14:101783102-101783124 GAGAGGAGGAGAGAGAGAGGGGG - Intronic
1122593531 14:102872489-102872511 TAGCTGAGGACAGCCACAGGGGG - Intronic
1122733357 14:103819304-103819326 TTGTTGAGAACAGACTGAGGCGG + Intronic
1122969969 14:105148525-105148547 CAGGTGAGGACAGAGAGGGGCGG + Intronic
1125038776 15:35158830-35158852 TAGGTGAGTAAAGTCAGAGGTGG - Intergenic
1126796395 15:52263539-52263561 TGGATGAGGCCAGAGAGGGGAGG - Intronic
1126849789 15:52789918-52789940 TCGATGTGGCCAGGCAGAGGCGG + Exonic
1127444890 15:59050966-59050988 TAGCTGTGGAGAGACAGAGCAGG + Intronic
1128469741 15:67942247-67942269 AATCTGAGGGCAGACAGAGGAGG - Intergenic
1130780327 15:87030914-87030936 GAGCTGAGGAAGGACAGAGGTGG + Intergenic
1131115450 15:89792411-89792433 CAGATGAAGACTGGCAGAGGAGG + Intronic
1131953892 15:97710732-97710754 GAGATGAGGCCAGACAGTGCAGG + Intergenic
1132349327 15:101129141-101129163 TAGATGAGATCAGAAGGAGGTGG + Intergenic
1133395702 16:5445577-5445599 TAGGTGAGGACAGTCAGAGGTGG + Intergenic
1134317075 16:13128368-13128390 TAGATGAAGAAACACAGTGGTGG + Intronic
1134349939 16:13427695-13427717 GAGATGAGTAGAGACAGAGCAGG + Intergenic
1136359618 16:29770296-29770318 GAGGTGAGGAAAGACAAAGGAGG + Intergenic
1139594832 16:67951482-67951504 TAGAAGTCGACAGACAAAGGTGG + Intronic
1140127664 16:72131627-72131649 TAGATGACTACAGTCAGAGCAGG + Intronic
1140469067 16:75204688-75204710 TAGATGAGAGCAGAGAGGGGTGG + Intronic
1140472717 16:75224251-75224273 TAGATGAGAGCAGAGAGGGGTGG - Intronic
1140559928 16:75967114-75967136 GAGAGGAGGACAGACGGAAGAGG + Intergenic
1140933918 16:79653342-79653364 TAGATAAGCACAGGCAGAAGAGG + Intergenic
1141009664 16:80385741-80385763 TAAATGAAGACAGAGAGAAGAGG - Intergenic
1141255215 16:82395824-82395846 GAGATGAGGATAGACAAAAGAGG - Intergenic
1142614070 17:1124954-1124976 TAGACGGGGAGAGACAGGGGCGG + Intronic
1143382136 17:6503171-6503193 GGCATGAGGACAGAGAGAGGAGG - Intronic
1143740782 17:8952505-8952527 TAGAGTAGGACACACAGAGGTGG - Intronic
1144083516 17:11785819-11785841 CAGATGAGGACAGAAAGGTGTGG - Intronic
1144187362 17:12809194-12809216 CAGAAGAGGACAGAAAGATGTGG - Intronic
1144465661 17:15495014-15495036 TGTATGAGGAGAGACAGAGGAGG + Intronic
1145007914 17:19347908-19347930 CACATGAGGACACACAGGGGAGG + Intronic
1145885840 17:28381926-28381948 TAGATGAAGCAAGACAAAGGAGG + Intronic
1145987943 17:29060241-29060263 CAGAGGAGGACTCACAGAGGAGG + Intergenic
1147531067 17:41278272-41278294 TAGAGGAGGAGAGAAAGAAGAGG + Intergenic
1147878588 17:43639313-43639335 CAGATGAGGAAAGCCAGAAGAGG + Intergenic
1148095518 17:45050489-45050511 TTGGTGAAGACAGACAGAGGAGG + Intronic
1149029373 17:52066255-52066277 TAGAAGAAGACAGAAAGATGTGG + Intronic
1150516717 17:65819795-65819817 AAGATCAGGAAAGACAGGGGAGG + Intronic
1151176560 17:72293439-72293461 TAGATGAAGACAGAAAGACGAGG - Intergenic
1152532543 17:80927820-80927842 GAGATGAGGGCAGGCGGAGGAGG - Intronic
1152610222 17:81311681-81311703 TGGATGAGGGCAGGGAGAGGTGG + Exonic
1154092702 18:11379897-11379919 TAGGTGAGAACAGACACAGAGGG + Intergenic
1154958146 18:21279796-21279818 TAAATCAGGACAGCCACAGGTGG - Intronic
1155317469 18:24586770-24586792 CAGATGTGCACAGAGAGAGGTGG - Intergenic
1157490037 18:48116710-48116732 TAGATGAGGAATGACAGAGAGGG - Intronic
1158254884 18:55534492-55534514 TTGATGAGTGCAGACAGGGGAGG - Intronic
1158571989 18:58604009-58604031 GAGATGAGGACAGCATGAGGAGG + Intronic
1159783040 18:72681482-72681504 AAGATGAAGACAGAGAGAGAGGG - Intergenic
1160144712 18:76354036-76354058 TAGATGAAAACTGACAGAGAAGG - Intergenic
1160333112 18:78013585-78013607 AAAATGTGGACAGACAGATGTGG + Intergenic
1160406906 18:78652621-78652643 TAGATGAGGACAGGCAGGCCAGG + Intergenic
1160681600 19:413926-413948 TGGAAGAGGACAGACAGAGGTGG + Intergenic
1160690062 19:457527-457549 CAGAAGAGGACAAACAGATGAGG - Intronic
1161351019 19:3791730-3791752 CAGATTATGACAGCCAGAGGGGG - Intronic
1161634114 19:5376413-5376435 CAAATGAGGACAGAGAGAGTAGG - Intergenic
1162904540 19:13815990-13816012 GAGAAGAGGAAAGAAAGAGGTGG + Intronic
1165434548 19:35788854-35788876 TGAGTGAAGACAGACAGAGGGGG + Intergenic
1165905095 19:39188933-39188955 GAGATGAGGTCAGACAGAATGGG - Intergenic
1166109613 19:40614103-40614125 CGGAGGAGGAAAGACAGAGGTGG - Intronic
1166332568 19:42087554-42087576 CAGAAGAGAACAGAGAGAGGTGG + Intronic
1166653042 19:44589634-44589656 TAGATGAGGACACAGAGAACAGG + Intergenic
1167075098 19:47243634-47243656 GAGACTAGGAGAGACAGAGGTGG - Intergenic
1167110472 19:47457670-47457692 GAGATGAGGAGTGGCAGAGGCGG - Intronic
1167435251 19:49475198-49475220 GAGAGGAAGAGAGACAGAGGAGG + Intronic
1167671594 19:50856718-50856740 CAGAGAAGGACAGAGAGAGGGGG - Intronic
1168723535 19:58568764-58568786 TGGATGATGCCAGACAAAGGTGG + Intronic
925739282 2:6991514-6991536 CTGATGAGGATATACAGAGGAGG + Intronic
927253380 2:21018404-21018426 AAGATGAGGACAGAGAGATATGG - Intronic
927516512 2:23674877-23674899 CAGATGGGAGCAGACAGAGGGGG - Intronic
927982401 2:27382278-27382300 TAGAGGAGTATGGACAGAGGTGG + Intronic
928270422 2:29850295-29850317 CAGATGAGGAATGGCAGAGGCGG + Intronic
929265919 2:39919682-39919704 CAGATGAGGACTGACACAGCTGG - Intergenic
929564918 2:42978343-42978365 TAGAGGAGGACAAACAAGGGTGG - Intergenic
930709246 2:54534638-54534660 TAGTGGTGAACAGACAGAGGAGG - Intronic
931253074 2:60550618-60550640 AAAATGAGGACAGAAAGAAGTGG + Intronic
932712885 2:74080800-74080822 AAGATGAGGACAAACAGCTGAGG - Intronic
933208142 2:79533584-79533606 TAGATGATGAGAGACACAAGTGG + Intronic
933239637 2:79905690-79905712 GAGGTGAGGACAGGCAGAGCTGG + Intronic
935084100 2:99827773-99827795 TAGAAGAGGGCAGAGAGAGGAGG + Intronic
935349952 2:102144036-102144058 GAGCTGAGGAAAGCCAGAGGTGG + Intronic
935550591 2:104449342-104449364 TGGATCAGGAAAGACAGTGGAGG - Intergenic
936005394 2:108882724-108882746 TAGATGGTGAGAGAAAGAGGAGG - Intronic
936071944 2:109376932-109376954 AATGTGAGGACAGACAGAGATGG + Intronic
937308338 2:120885763-120885785 TGGAGGATGACAGACACAGGAGG + Intronic
937929904 2:127195938-127195960 TAGATTAGGGCAGCCAGAGTGGG - Intronic
939163827 2:138618849-138618871 GAGATGATTTCAGACAGAGGTGG - Intergenic
939550039 2:143603884-143603906 TAGATGAGGAAAGGAAGAAGAGG - Intronic
940547265 2:155103212-155103234 TGGAAGAGGACAGAAAGATGTGG - Intergenic
942879718 2:180844689-180844711 TAGTTGGGGAAAGACAGATGGGG + Intergenic
943376426 2:187082911-187082933 TAGATAAGCACATAGAGAGGTGG - Intergenic
946019088 2:216627482-216627504 TAGATGGAGAGGGACAGAGGGGG - Intergenic
947008277 2:225537169-225537191 TAAATGAAGACAGAGAGAGAAGG - Intronic
947914610 2:233823223-233823245 GATATGAGGGCAGAAAGAGGAGG + Intronic
948440380 2:237983391-237983413 AAGGTGAAGACAGACAGTGGAGG - Intronic
1169723384 20:8702999-8703021 GAGAGGTGGACAGAGAGAGGAGG + Intronic
1169837312 20:9894866-9894888 TAAATGAGAAAACACAGAGGAGG - Intergenic
1169905886 20:10603630-10603652 TATATGTGAAGAGACAGAGGTGG - Intronic
1169924940 20:10773336-10773358 AAGATGAGGAAAGAGGGAGGAGG - Intergenic
1170871299 20:20209000-20209022 TAGATGAGTACATGCAGAAGGGG - Intronic
1172866343 20:38101876-38101898 AGGATGAGGACAGAGAGAGAGGG - Intronic
1173377176 20:42496489-42496511 AAGATGAGGAAAGACATAGAAGG - Intronic
1173389785 20:42621701-42621723 TAGATGAGATCAGAAAGAGAAGG - Intronic
1174554002 20:51381152-51381174 GTGATGAGGACAGGCAGAAGGGG + Intergenic
1175199503 20:57267661-57267683 TGGATGAGGAGAGACAGGAGAGG - Intergenic
1175279585 20:57794158-57794180 TAGAGGAGGAGAGAGTGAGGAGG + Intergenic
1176049355 20:63108443-63108465 TATGTGGGGACACACAGAGGAGG + Intergenic
1176235622 20:64052244-64052266 TAGTCCAGGACAGACTGAGGTGG - Intronic
1177022860 21:15884903-15884925 TAGGTGAGGACACAGAGAGAAGG - Intergenic
1177320426 21:19513221-19513243 TAGCTGAGCTCAGACAGAAGTGG - Intergenic
1177734366 21:25070494-25070516 AAGAGGAGGACAGAAATAGGTGG - Intergenic
1178348389 21:31851612-31851634 GAGATGGAGACAGACAAAGGGGG + Intergenic
1178742398 21:35214245-35214267 TTGATGAAGACAGACAGACAAGG + Intronic
1179529291 21:42008046-42008068 TATGTGAGGACAAACAGATGTGG - Intronic
1180232294 21:46434442-46434464 AAGATGCAGACACACAGAGGCGG - Intronic
1181361669 22:22342709-22342731 GAGATGAGGACAGAGTGAGAAGG + Intergenic
1181428782 22:22863906-22863928 CAGAAGAAGACAGACAGATGAGG - Intronic
1181839205 22:25641303-25641325 AGGAAGAGGACAGAAAGAGGAGG - Intronic
1182473900 22:30565378-30565400 TAGTAGAGGGCAGACAGAGCTGG + Intronic
1183373227 22:37447532-37447554 GAGATGGGGACAGATGGAGGAGG + Intergenic
1184116097 22:42423244-42423266 CAGATGGAGACAGAAAGAGGTGG + Intronic
1184211512 22:43038557-43038579 TAGATGAGCACAGACAGGTCCGG - Intergenic
1184253317 22:43273204-43273226 CAGATGGAGACAGACAGAGCTGG + Intronic
1184273270 22:43396778-43396800 GAGGTGAGGACAGAGAGAGTGGG + Intergenic
1184768813 22:46586420-46586442 GAGGGGAGGGCAGACAGAGGAGG - Intronic
1185201814 22:49511503-49511525 TATATGAGGACACAGAGAGAAGG + Intronic
949261634 3:2108214-2108236 TAGACAAGGACAGTAAGAGGAGG - Intronic
950272877 3:11633272-11633294 TAGAGTAAGCCAGACAGAGGAGG + Intronic
951950803 3:28198518-28198540 CAGATGAAGTCAGACAGAGAAGG - Intergenic
952219962 3:31315168-31315190 TAGATATGGCCAGACTGAGGTGG + Intergenic
952567914 3:34680734-34680756 TAGATTGGGACATAGAGAGGTGG - Intergenic
952823560 3:37506108-37506130 TAGCTGGGGTCAGACAGAAGAGG + Intronic
953607502 3:44421222-44421244 TAGATGGGGCCAGGCAGATGCGG + Intergenic
953612528 3:44459176-44459198 TAGATGAAGAGATACACAGGGGG - Intronic
954250706 3:49365112-49365134 TAGATGAGGGAAGACAGAATAGG - Intronic
954288300 3:49635239-49635261 GAGATGTGGACAGAGAGAAGAGG + Intronic
956095513 3:65712016-65712038 TTCATGAGGACAGAAAGAGAGGG + Intronic
957490496 3:80920968-80920990 CAGAAGAAGACAGAAAGAGGTGG + Intergenic
959154875 3:102654639-102654661 AAGATGACCACTGACAGAGGAGG + Intergenic
960944136 3:122954457-122954479 AAGGCGAGGACAGACTGAGGAGG - Intronic
961021241 3:123508975-123508997 TAGATGAGGTCATGCGGAGGTGG - Intronic
962215350 3:133516180-133516202 AAGATGATGAAAGAAAGAGGAGG - Intergenic
962221876 3:133571473-133571495 TAGATGAGGAAAGAAAGAGAGGG + Intergenic
963756883 3:149243660-149243682 TGGATGAACACAGACAGAGGTGG - Intergenic
966815040 3:183883623-183883645 AAAATGAGGACAGATGGAGGTGG - Intronic
966939557 3:184736947-184736969 AAGATGAGAACATATAGAGGAGG - Intergenic
967293831 3:187946865-187946887 TAGATGTGCGCAGACATAGGTGG + Intergenic
969189823 4:5508461-5508483 CAGACCAGGACAGACAGAAGGGG - Intergenic
970243022 4:14029218-14029240 TAGAGGAGGAGAGAGACAGGAGG + Intergenic
970306273 4:14735442-14735464 AAGATGAGGTCAGAGAGATGAGG + Intergenic
970363160 4:15330587-15330609 TATGTGAGGACACAGAGAGGAGG - Intergenic
970581958 4:17481711-17481733 TAGAGTAGGACATAGAGAGGTGG - Intronic
970638578 4:18037830-18037852 GAAAAGAGGACAGCCAGAGGAGG - Intergenic
972203940 4:36748102-36748124 CAGAGGAGGACAGCCAGAGCAGG + Intergenic
972927783 4:44033217-44033239 GTGATGGGGACAGAGAGAGGAGG + Intergenic
975489674 4:74974778-74974800 TAGATGAGGTCAGAAGGATGGGG + Intronic
976550539 4:86389921-86389943 TAGATGGGGGCAGAGAGAGAGGG - Intronic
976850275 4:89536739-89536761 TATATGAGGACACAGAGAGAAGG + Intergenic
977499602 4:97822392-97822414 TAGAAGAAGACAGAAAGATGAGG - Intronic
978235591 4:106454756-106454778 TGGATGAAGAGAGAAAGAGGTGG + Intergenic
978611130 4:110541389-110541411 TTGATGTGGACAGTCAGAGGAGG - Intronic
981589203 4:146339018-146339040 TCAATGAGGACAGAGAAAGGAGG + Intronic
982610428 4:157567549-157567571 CAGATGAGGAAAGACACATGGGG + Intergenic
982774426 4:159427480-159427502 TAGAGGAGTTCAGATAGAGGTGG + Intergenic
983566032 4:169152858-169152880 TAGTTGAGGACAGGAAGAGAGGG + Intronic
983890849 4:173028468-173028490 TATAGGAGTACAGAAAGAGGGGG - Intronic
984045362 4:174791204-174791226 TATTTGATGACAGACAGAAGAGG + Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985467989 5:15735-15757 TGGAAGAGGACAGTCTGAGGAGG + Intergenic
986660644 5:10057051-10057073 TAGATAAGGCCATACAGAGAAGG + Intergenic
988714112 5:33807928-33807950 TAGAAGAGGAAAGAAAGAGATGG + Intronic
990928811 5:61062600-61062622 TAGAGGAGAAGAGACAGAGAAGG + Intronic
991589374 5:68233451-68233473 TAGAGGAGGACACATGGAGGGGG + Intronic
991953852 5:71972640-71972662 CAGATGAGGAGCCACAGAGGAGG + Intergenic
992418928 5:76581530-76581552 TAATTTAGGACAGAAAGAGGAGG - Intronic
992908338 5:81370461-81370483 AAGATGAGGCCAGACTGCGGTGG + Intronic
994527714 5:100927535-100927557 GAGATAAGGAAAGAGAGAGGAGG - Intergenic
995634203 5:114166879-114166901 TAGTGGAGGGCAGACAGAGATGG - Intergenic
997045481 5:130311834-130311856 TAGATGAAGAGAGACATAGACGG - Intergenic
998002727 5:138637585-138637607 TGGCTGAGCACAGAGAGAGGAGG - Intronic
999161297 5:149501727-149501749 TAATTGAGGGCAGGCAGAGGTGG - Intronic
999279416 5:150355252-150355274 TAGAAGAGGACTGAGACAGGGGG - Intergenic
999288900 5:150410637-150410659 TAAATGAGGAAATAAAGAGGGGG - Intronic
999319538 5:150604983-150605005 CAGATGAGGAAACACAGACGTGG - Intronic
999739881 5:154542085-154542107 TAGCTGAGGAGTGACAGAGAAGG + Intergenic
999772333 5:154785101-154785123 AAAATGAGGAAAGACAGATGGGG - Intronic
1000007719 5:157202923-157202945 GTGATGAGGGCAGACAGTGGAGG - Intronic
1000165927 5:158648685-158648707 AAGATGAAGACAGATAGAGGTGG + Intergenic
1000282525 5:159794357-159794379 AAGATGAAGACAGACATTGGGGG + Intergenic
1001318674 5:170662759-170662781 GAAAGGAGGATAGACAGAGGAGG - Intronic
1002493145 5:179593942-179593964 TAGAAGAAAACAGACAGTGGAGG - Intronic
1002724568 5:181286153-181286175 TGGCTGAGCACAGACAGAAGAGG - Intergenic
1002776592 6:333175-333197 GAAATGAGGACAGAGACAGGAGG + Intronic
1002933326 6:1650132-1650154 TAGATGAGGAAAGGAAAAGGAGG - Intronic
1004085974 6:12449638-12449660 CAGAAGATGACAGACAGAAGAGG + Intergenic
1004091104 6:12502745-12502767 TAGATGGGGAGCGAGAGAGGAGG + Intergenic
1005017360 6:21386884-21386906 TAGAAGGGGACAGACATAGCTGG - Intergenic
1007369385 6:41416422-41416444 GAGCGGAGGAGAGACAGAGGGGG + Intergenic
1007413651 6:41679582-41679604 TGGGTTAGGACAGACTGAGGTGG - Intergenic
1007836792 6:44680152-44680174 GAGATGAACACAGACAGTGGTGG + Intergenic
1009840097 6:69060250-69060272 GAGAGAAGGAGAGACAGAGGAGG - Intronic
1009891493 6:69689403-69689425 AAGAAGAGGAAAGACAGAGAAGG + Intronic
1010053348 6:71534436-71534458 AAGATGGGGAGAAACAGAGGTGG + Intergenic
1010984840 6:82411920-82411942 TTGATGAGAATAGACAGTGGAGG - Intergenic
1011422992 6:87193948-87193970 AAGATGAGGAGAGATAGAAGAGG + Intronic
1014089850 6:117391421-117391443 AAGAGGAGGACAGAGTGAGGAGG + Intronic
1014402696 6:121010673-121010695 TAGAAAAGGATAGCCAGAGGTGG - Intergenic
1014762744 6:125375830-125375852 AAGATGAGAGAAGACAGAGGTGG - Intergenic
1015700741 6:136033588-136033610 GAGATGAGGAAAGACAGGTGGGG - Intronic
1016217854 6:141624848-141624870 TAGAGCAGGAGAAACAGAGGTGG - Intergenic
1017962239 6:159232803-159232825 GAGATGAGAAGAGACGGAGGAGG - Exonic
1018886376 6:167941106-167941128 GAGATGTGGACAGACACAGAGGG + Intronic
1018886411 6:167941278-167941300 GAGATGTGGACAGACACAGAGGG + Intronic
1018912845 6:168113370-168113392 CAGCAGAGGACAGACAGATGGGG + Intergenic
1019154217 6:170028473-170028495 TAGATGAAGAGATACAGAGACGG + Intergenic
1019154219 6:170028521-170028543 GAGATGAAGACAGACAGAGATGG + Intergenic
1019201146 6:170316818-170316840 GGGATGGGGACAGACAGTGGCGG - Intronic
1019316068 7:387514-387536 TCGTGGAGGATAGACAGAGGTGG - Intergenic
1019364118 7:622871-622893 TAAAGGAGGACAGACTGAGCAGG - Intronic
1019603540 7:1897347-1897369 GAGATGAGGACAGGCAGAGACGG - Intronic
1020215561 7:6187442-6187464 CAGATGATGACTTACAGAGGAGG + Intronic
1020744604 7:12066223-12066245 AGGATGAGTAAAGACAGAGGAGG + Intergenic
1021926946 7:25543126-25543148 TAGAAGGGGAGACACAGAGGAGG - Intergenic
1022910335 7:34894817-34894839 CAGAAGAGGACAGAAAGATGAGG + Intergenic
1023156219 7:37255298-37255320 CACATGAGGACAGAGAGAGAAGG + Intronic
1023761998 7:43473158-43473180 GAGATGAAGCCAGACAGAGTGGG - Intronic
1023837927 7:44079464-44079486 TGGGTGAGGACAGACAGTCGTGG - Intronic
1025263330 7:57437476-57437498 TAGAGGGGGACAGGCAGAGCTGG - Intergenic
1025635916 7:63318648-63318670 TAGAGGGGGACAGGCAGAGCTGG + Intergenic
1025646780 7:63429532-63429554 TAGAGGGGGACAGGCAGAGCTGG - Intergenic
1025740458 7:64192082-64192104 TAGAGGGGGACAGGCAGAGCTGG - Intronic
1026116803 7:67502694-67502716 TAGATGAGGTCATAAAGATGGGG - Intergenic
1026605189 7:71809918-71809940 TAGATGAGGAAACACAGAGAAGG + Intronic
1028702537 7:93797281-93797303 TAGATGTGGTGAGACAGAAGAGG + Intronic
1030019783 7:105261967-105261989 GAGATGAGGACAGAGAAAAGAGG + Intronic
1030586214 7:111422369-111422391 TAGAAGAGGACAGAAACAAGTGG - Intronic
1031055022 7:116983699-116983721 TGGGTGAAGACAGACAGTGGGGG - Intronic
1031197806 7:118639032-118639054 TAGTTCAGGACAGAATGAGGTGG + Intergenic
1034211457 7:149367260-149367282 TAGATGGGGACAGGGAAAGGAGG - Intergenic
1035280712 7:157776423-157776445 AGGAAGAGGAGAGACAGAGGAGG - Intronic
1035476956 7:159150567-159150589 AGGATGGGGACAGACAGATGAGG + Intergenic
1036010110 8:4712556-4712578 TAGAAGAGAACAGAAAGAAGGGG + Intronic
1041023335 8:53659451-53659473 GACATGAGGACAGACGAAGGCGG - Intergenic
1041036056 8:53791730-53791752 GAGAGGCGGACAGCCAGAGGAGG - Intronic
1041871044 8:62634670-62634692 TAGGAGAGGAGAGACAGAGATGG + Intronic
1041977705 8:63818357-63818379 CAGATGAAGACAGAAAGATGTGG - Intergenic
1042745971 8:72106255-72106277 TAAATGAGTACGTACAGAGGAGG - Intronic
1042959007 8:74282668-74282690 GAGATGAGGATAGCCAGAGGAGG + Intronic
1044384150 8:91567335-91567357 TATGAGAGGACAGAAAGAGGGGG + Intergenic
1045616981 8:103926997-103927019 TAGATGAGGAAACACAGAAAAGG - Intronic
1046520283 8:115317477-115317499 GAGATGAGGAAGGACAGAGAGGG - Intergenic
1046821523 8:118638723-118638745 CAGAGCAGGACAGACAGAAGTGG + Intergenic
1047031023 8:120880730-120880752 TAGAAGAAGAAAGACAGTGGGGG + Intergenic
1047200174 8:122758623-122758645 TAGATGAGGACAAAGAAGGGGGG + Intergenic
1048244291 8:132775911-132775933 GAGGTGAGGCCAGACAGAGAGGG - Intronic
1048395933 8:134014009-134014031 CAGATGAGAACATACAGAGCAGG + Intergenic
1048611494 8:136027868-136027890 TTGATCAGGAAAGACAGAGGTGG + Intergenic
1050412918 9:5385021-5385043 GAGATGAGGTCAGATGGAGGTGG + Intronic
1050501048 9:6297728-6297750 AAGATGAGAAGAGACAAAGGAGG + Intergenic
1050595736 9:7203073-7203095 GAGGTTAGCACAGACAGAGGCGG + Intergenic
1050697217 9:8292767-8292789 TGGATGAGGACACTCTGAGGAGG - Intergenic
1051784063 9:20722387-20722409 AAGATGATGTCAGACAGAGAAGG - Intronic
1054935288 9:70680875-70680897 AGGATGAGGACAGATAGATGAGG + Intronic
1056026457 9:82501994-82502016 TAGCTGAGATAAGACAGAGGAGG - Intergenic
1056877610 9:90349640-90349662 TAGCTGAGTTCAGACAGAAGTGG - Intergenic
1059458630 9:114415490-114415512 TAGATGAGGTGAGACAGCTGAGG - Intronic
1060517182 9:124273243-124273265 TGGATGATGGCAGACAGAGCAGG - Intronic
1060906892 9:127314694-127314716 TGTATGAGGAGAGACAGAGTGGG + Intronic
1061319040 9:129816126-129816148 TGGTTGAGGATAAACAGAGGAGG - Intronic
1062012750 9:134275755-134275777 AGGATGGGGACAGACAGAAGTGG + Intergenic
1062080829 9:134622552-134622574 GAGAGAAGGGCAGACAGAGGAGG - Intergenic
1062253561 9:135610195-135610217 TAGAGGCAGACAGACAGAGATGG + Intergenic
1062375237 9:136259087-136259109 CAGATGGGGACAGACTGGGGTGG + Intergenic
1062715423 9:138007849-138007871 GAGACGAGGACAGACAGACGGGG - Intronic
1185604800 X:1362226-1362248 TAGACAAAGACAGACAGAGTGGG - Intronic
1185636972 X:1559897-1559919 GAAAAGAGGACAGACAGAGTGGG + Intergenic
1185758736 X:2673278-2673300 GAGATGAAGACAGACACAGAGGG + Intergenic
1185961106 X:4546325-4546347 TACATGAGGACATACAGAGCAGG - Intergenic
1188875056 X:35419272-35419294 GGGCTGAGGAAAGACAGAGGTGG - Intergenic
1190212858 X:48461392-48461414 GAGGTACGGACAGACAGAGGCGG - Intronic
1190371839 X:49749955-49749977 TAGATGAGGAGGGGCAGATGTGG + Intergenic
1190387515 X:49897400-49897422 TAGAAGAGGACAGGAAGATGTGG + Intergenic
1190752600 X:53375258-53375280 TAGATCAGGACAGGCAGAGGTGG - Exonic
1192534257 X:71913828-71913850 CAGGGGAGGACAGAGAGAGGAGG + Intergenic
1192849799 X:74942778-74942800 TAGATGAGTTCAGGCAGAAGTGG + Intergenic
1193455684 X:81728891-81728913 TAGAAGAGGACAGGAAGATGTGG + Intergenic
1194281925 X:91963563-91963585 CAGAAGAAGACAGAAAGAGGTGG - Intronic
1196753552 X:119138613-119138635 CAGATGAGGACAGAGAGGGCAGG + Intronic
1196783247 X:119400843-119400865 TTGATGAGGGCAAGCAGAGGTGG - Intronic
1198091747 X:133337763-133337785 GTGATCAGGAGAGACAGAGGAGG + Intronic
1199883612 X:151996635-151996657 GAGTTGAGGTCAGAAAGAGGAGG + Intergenic
1200599521 Y:5188219-5188241 CAGAAGAAGACAGAAAGAGGTGG - Intronic
1201652651 Y:16307412-16307434 AAGAGGAAGACAGAGAGAGGAGG + Intergenic