ID: 1072328110

View in Genome Browser
Species Human (GRCh38)
Location 10:94318575-94318597
Sequence GCTTGGGTAGCACAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328110_1072328118 23 Left 1072328110 10:94318575-94318597 CCACCATCCTGTGCTACCCAAGC 0: 1
1: 0
2: 1
3: 19
4: 257
Right 1072328118 10:94318621-94318643 ATCACCCACACTCAGCACCTTGG No data
1072328110_1072328115 0 Left 1072328110 10:94318575-94318597 CCACCATCCTGTGCTACCCAAGC 0: 1
1: 0
2: 1
3: 19
4: 257
Right 1072328115 10:94318598-94318620 TGAAATTGTGTCCATCCTTGTGG No data
1072328110_1072328119 24 Left 1072328110 10:94318575-94318597 CCACCATCCTGTGCTACCCAAGC 0: 1
1: 0
2: 1
3: 19
4: 257
Right 1072328119 10:94318622-94318644 TCACCCACACTCAGCACCTTGGG No data
1072328110_1072328121 27 Left 1072328110 10:94318575-94318597 CCACCATCCTGTGCTACCCAAGC 0: 1
1: 0
2: 1
3: 19
4: 257
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328110 Original CRISPR GCTTGGGTAGCACAGGATGG TGG (reversed) Intronic
900037701 1:431233-431255 GGTGGGGTAGCTCAGGATGCTGG - Intergenic
900059331 1:666976-666998 GGTGGGGTAGCTCAGGATGCTGG - Intergenic
900797107 1:4714800-4714822 GGCTGGGAAGCTCAGGATGGTGG - Intronic
901169461 1:7246134-7246156 GCTGGGCTAGCACAGGCTGTGGG - Intronic
901456499 1:9366107-9366129 GCTCTGGGAACACAGGATGGAGG + Intronic
903139859 1:21332824-21332846 GCTGCGGGAACACAGGATGGGGG + Intronic
905452236 1:38064201-38064223 GAGTGGGTAACACAGGGTGGGGG + Intergenic
905874803 1:41426055-41426077 GCTTGGGCAGGACTGGGTGGTGG + Intergenic
905874815 1:41426099-41426121 GCTTGGGCAGGACTGGGTGGTGG + Intergenic
905874828 1:41426143-41426165 GCTTGGGCAGGACTGGGTGGTGG + Intergenic
905874839 1:41426187-41426209 GCTTGGGCAGGACTGGGTGGTGG + Intergenic
905874874 1:41426319-41426341 GCTTGGGCAGGACTGGGTGGTGG + Intergenic
905998409 1:42402207-42402229 ACTTGGGTATCTCAGGGTGGGGG - Intronic
907157472 1:52347649-52347671 GTTTGGGAGGCAGAGGATGGCGG - Intronic
907384413 1:54116827-54116849 GCTAGGGGAGCACAGGAGGAAGG + Intergenic
907486898 1:54784299-54784321 ACTAGAGGAGCACAGGATGGTGG - Intronic
907962146 1:59293961-59293983 GTTTTTATAGCACAGGATGGGGG - Intergenic
914334246 1:146700549-146700571 CCCTGGGTAGCTCAGGATGCTGG + Intergenic
915268566 1:154735588-154735610 CCTTGAGTAGCACAGGCTGGTGG + Intronic
923364914 1:233249703-233249725 GCTTGGGAAGGACTGCATGGCGG + Intronic
924708941 1:246518806-246518828 TTTTGGGTTGGACAGGATGGCGG - Intergenic
1062948972 10:1482165-1482187 ACTTGGGAAGAACAGTATGGCGG + Intronic
1064188239 10:13182365-13182387 GCTTGGGAGGCTGAGGATGGAGG + Intronic
1064281116 10:13952390-13952412 GCTTGGGAGGCTGAGGATGGAGG + Intronic
1067295504 10:44973215-44973237 GCCTGGGGAGTGCAGGATGGGGG - Intronic
1069346476 10:67476475-67476497 GGTGGGGTAGCTCAGGCTGGAGG - Intronic
1069807998 10:71137930-71137952 GGGTGGGTAACACAGGAGGGCGG + Intergenic
1069866185 10:71504584-71504606 GTTTGGGTGGCACAGAGTGGAGG + Intronic
1072328110 10:94318575-94318597 GCTTGGGTAGCACAGGATGGTGG - Intronic
1072453488 10:95557719-95557741 GGTTTGGTAGCCTAGGATGGGGG - Intronic
1073652429 10:105375835-105375857 GGTTGGAAGGCACAGGATGGAGG - Intergenic
1074067269 10:110027939-110027961 GCTTGGGTAGAAAAGGTTGTGGG + Intronic
1075047529 10:119158167-119158189 GCTGGGGCAGGAGAGGATGGTGG + Intronic
1076947323 10:133660136-133660158 GCTTAGGAAGCAGGGGATGGTGG + Intergenic
1076964428 11:69156-69178 GGTGGGGTAGCTCAGGATGCTGG - Intergenic
1077344035 11:2038221-2038243 GGTGGGGCAGCACGGGATGGGGG + Intergenic
1077353269 11:2102855-2102877 GCTTGGGTGGAGCAGGGTGGAGG - Intergenic
1079322448 11:19462694-19462716 GTTTGAGTAGCACAGGTTTGAGG + Intronic
1080445796 11:32335725-32335747 ACTTGGGTAGCTGAGGTTGGAGG + Intergenic
1083289193 11:61680440-61680462 CCTTGGGGAGCCCAGGATGGAGG + Exonic
1085339512 11:75722085-75722107 GCCTGGGGGGCTCAGGATGGGGG + Intronic
1085702782 11:78760075-78760097 GTTTGGGTTGCAGAGTATGGGGG - Intronic
1089157661 11:116414675-116414697 GGTTGCGTAGCTCTGGATGGAGG + Intergenic
1089303903 11:117515067-117515089 GCTGCGATAGCCCAGGATGGTGG + Intronic
1089351969 11:117826583-117826605 GCTTTGGTAGCACATCTTGGAGG - Intronic
1090442598 11:126736845-126736867 TCCTGGGCAGCACAGGGTGGGGG - Intronic
1202827021 11_KI270721v1_random:93410-93432 GGTGGGGCAGCACGGGATGGGGG + Intergenic
1091621984 12:2095838-2095860 GCCTGGGTCCCACTGGATGGAGG + Intronic
1094291928 12:28860706-28860728 GCTTGAGTAGAACAGGAAAGAGG + Intergenic
1094480555 12:30877859-30877881 GCTTTGAAGGCACAGGATGGGGG + Intergenic
1099201168 12:79678890-79678912 GGGTGGGAGGCACAGGATGGTGG + Intronic
1100373461 12:93990865-93990887 GCTTGGGTTGCAGGGGAGGGCGG + Intergenic
1102848833 12:116218840-116218862 GCTGGGGTGGCTCAGGCTGGAGG - Intronic
1104856575 12:131905028-131905050 GCTTGGGGTGCACAGGCTGTGGG + Intronic
1104859242 12:131916134-131916156 GGTGGGGGAGCCCAGGATGGGGG - Exonic
1106685398 13:32053793-32053815 TCTTGGGTAGAACAGGTTGTGGG + Intronic
1107664184 13:42672131-42672153 ACTTGGGAAGCAGAGGTTGGAGG + Intergenic
1111711146 13:91815908-91815930 GCTGGGGTAGCAGAGGAAGTGGG - Intronic
1113927941 13:113951609-113951631 GCTTGGGGAGCAGGGCATGGGGG - Intergenic
1118720091 14:68587711-68587733 CCTTGGGTAGCAAAGGCTGGCGG - Intronic
1121161966 14:91751802-91751824 ATTTTGGAAGCACAGGATGGAGG - Intronic
1121231429 14:92361747-92361769 GTTTGGGTGGGGCAGGATGGTGG + Intronic
1121317536 14:92971119-92971141 CCTTGGGTGGCACAGCAAGGGGG - Intronic
1202921377 14_KI270723v1_random:32687-32709 GCTTAGGAAGCAGGGGATGGTGG + Intergenic
1202923533 14_KI270724v1_random:4893-4915 GCTTAGGAAGCAGGGGATGGTGG - Intergenic
1123552651 15:21397941-21397963 CCTTGAGTAGCAGAGGTTGGTGG + Intergenic
1123588898 15:21835329-21835351 CCTTGAGTAGCAGAGGTTGGTGG + Intergenic
1124855259 15:33381493-33381515 GCTGGGGCAGCAGAGGATAGTGG - Intronic
1125770129 15:42159671-42159693 GCTGGGATAGCGCAGGAAGGTGG - Exonic
1126361383 15:47849748-47849770 GGCTGGGTAGCACATGATGAGGG - Intergenic
1126382718 15:48065583-48065605 GCTTGGGAGGAAAAGGATGGTGG - Intergenic
1127681817 15:61305056-61305078 GCTTGGGTAGCACAGACACGGGG + Intergenic
1129676999 15:77637113-77637135 ACTTGGGCAGCACTGGATGAGGG - Intronic
1129888261 15:79053714-79053736 GGGTGGGTGCCACAGGATGGAGG + Intronic
1130990674 15:88873965-88873987 GCTGGGCTGGCACCGGATGGTGG - Exonic
1131040923 15:89266103-89266125 ACTTGGGAAGCAGAGGCTGGAGG - Intronic
1131311029 15:91290027-91290049 GCTGGAATAGCACAGGGTGGGGG + Intronic
1131484874 15:92811762-92811784 ACTTGGGAAGCTCAGGCTGGAGG - Intergenic
1132296513 15:100738706-100738728 GCTAGGGCAGCAAAGGCTGGTGG + Intergenic
1132444122 15:101896027-101896049 GGTGGGGTAGCTCAGGATGCTGG + Intergenic
1202961001 15_KI270727v1_random:125161-125183 CCTTGAGTAGCAGAGGTTGGTGG + Intergenic
1132748497 16:1446794-1446816 GCTGGGGCAGCACAGGCAGGGGG + Intronic
1133401027 16:5487138-5487160 GCTTGGATAGCACAGAATAGGGG - Intergenic
1133736263 16:8618113-8618135 ACTTGGGAAGCAGAGGAGGGAGG - Intergenic
1136317872 16:29464827-29464849 ACTTGGGAAGCAGAGGCTGGAGG + Exonic
1136350196 16:29701621-29701643 GCTTCTGTAGCATCGGATGGTGG - Intergenic
1136432447 16:30204172-30204194 ACTTGGGAAGCAGAGGCTGGAGG + Exonic
1137290200 16:47047195-47047217 GCTGGAGTAGTAGAGGATGGGGG + Intergenic
1137456578 16:48622541-48622563 GTTTGGGAAGCCCAGGCTGGAGG - Intergenic
1138396195 16:56706660-56706682 GCTTGGGTAGCTGAGGTGGGAGG - Intronic
1141578859 16:84983485-84983507 CCTTGGGCAGCACAGGCAGGGGG + Intronic
1142288648 16:89182251-89182273 GCTTGGGGAGGGCAGGCTGGGGG - Intronic
1142625421 17:1188692-1188714 GGTTGGGGAAAACAGGATGGCGG + Intronic
1142852122 17:2709369-2709391 GCCTGGGTGGGACAGGAAGGAGG - Intronic
1143208586 17:5165470-5165492 GCTTGGGAGGCTGAGGATGGAGG + Intronic
1143362816 17:6385577-6385599 CCTTGGGTGGAACAGGAAGGGGG - Intergenic
1143870895 17:9956730-9956752 GCCTGGGCAGCAAAGGGTGGTGG - Intronic
1144101348 17:11944837-11944859 GTTTGGGAAGCACAGCATGAAGG + Intronic
1146036710 17:29413485-29413507 GCTTGGGAAGCAGAGGTGGGAGG + Intronic
1147732677 17:42613874-42613896 GCCAGGGTAGCGCAGGGTGGTGG - Exonic
1147739935 17:42665703-42665725 GCCGGGGTAGCGCAGGGTGGTGG - Exonic
1148637604 17:49160601-49160623 GCTTGGGTATGACAGGATGGCGG - Exonic
1148856443 17:50581541-50581563 GGTGGGGTAGCGCAGGTTGGGGG - Intronic
1149488787 17:57066715-57066737 GCATGTGTGGCACAGGATAGTGG - Intergenic
1150270716 17:63862715-63862737 GCTTGGGCAGGACTGGATGAAGG + Intergenic
1150274345 17:63886236-63886258 GCTTGGGCAGGACTGGATGAAGG + Intergenic
1150276488 17:63901064-63901086 GCTTGGGCAGGACTGGATGAAGG + Intergenic
1150437912 17:65168330-65168352 GTATGGAGAGCACAGGATGGAGG - Intronic
1150639375 17:66939260-66939282 GCTGGGGGAGCACAAGTTGGGGG + Intergenic
1151704138 17:75757888-75757910 GCTTGGGTGTCAGAGAATGGGGG - Intronic
1152287724 17:79422356-79422378 GCTGTGGCAGCACAGGACGGAGG - Intronic
1152640562 17:81447565-81447587 GCTGGGGCAGCAGAGCATGGAGG + Exonic
1152805964 17:82356495-82356517 GCTTGTGCACCCCAGGATGGTGG + Intergenic
1153559591 18:6358620-6358642 GTTTGAGGAGCACAGGAAGGTGG - Intronic
1155256612 18:24003301-24003323 GCTTTGGGAGCACAGAATAGGGG - Intronic
1155316623 18:24578155-24578177 CCTTGGTTTGCACAGGAAGGCGG + Intergenic
1156364053 18:36409139-36409161 CCATGGTTAGCAGAGGATGGTGG - Intronic
1157687569 18:49654954-49654976 GATGGGGTGGCACATGATGGGGG + Intergenic
1158403745 18:57143145-57143167 GCTGGAGCAGCACATGATGGGGG + Intergenic
1159188234 18:65006894-65006916 ACTTGGACAGCACAGGAGGGGGG - Intergenic
1159646223 18:70921345-70921367 GGTTGGGTGGCACAGGACGCAGG - Intergenic
1160641231 19:138788-138810 GGTGGGGTAGCTCAGGATGCTGG - Intergenic
1160834559 19:1118511-1118533 GCTTGGGCACCACAGGAAGGGGG + Intronic
1161625762 19:5325649-5325671 GCTTGGGGAGCACAGATTGCCGG - Intronic
1163691246 19:18739622-18739644 GTTTGGGGAGCACAGCATGGTGG + Intronic
1163777938 19:19228685-19228707 GCTTGGGGAGCAGGGGCTGGGGG + Intronic
1165170060 19:33885982-33886004 ACTTGGGAAGCTGAGGATGGAGG - Intergenic
1165466276 19:35976949-35976971 GGCAGGGTGGCACAGGATGGTGG - Intergenic
1168082847 19:54022954-54022976 GCTTGGGAAGCCGAGGAGGGTGG + Intergenic
926036283 2:9638373-9638395 GCTTGGGGAATCCAGGATGGGGG - Intergenic
928247710 2:29645649-29645671 GCAGTGGTGGCACAGGATGGCGG - Intronic
930510283 2:52335848-52335870 ACTTAAGTAACACAGGATGGTGG - Intergenic
931582570 2:63792972-63792994 TCTTGAGTAGCACAGGAAGGAGG - Intronic
933810982 2:86032516-86032538 GGTTGGGTGGCAGTGGATGGAGG - Intronic
935256974 2:101319000-101319022 GCTTTGGTATCAGATGATGGTGG - Intergenic
941062354 2:160862133-160862155 GCTTAGGTAGTACAGGATTATGG - Intergenic
943141962 2:183993643-183993665 GGTTGGGTAGCTCAGGCTGCTGG + Intergenic
943674723 2:190705543-190705565 GCTTGGGTACCACTGGACAGCGG + Intergenic
946483170 2:220075813-220075835 GCTTGGCATGCACACGATGGAGG + Intergenic
948261306 2:236606337-236606359 GCTTGGGTAACAGAGAATGATGG - Intergenic
1170154337 20:13256002-13256024 GCTTGGGTATCACTGCCTGGTGG - Intronic
1171027426 20:21643704-21643726 CCTGGGGCAGCACAGGAAGGGGG + Intergenic
1171350575 20:24499472-24499494 GCCTGGGTAGCAGAGTAGGGTGG - Intronic
1172329627 20:34066243-34066265 GTTTGGGAAGCAAAGGAGGGTGG + Intronic
1172764111 20:37341916-37341938 GTTTGCGAAGCACAGCATGGCGG - Intergenic
1173768026 20:45631567-45631589 GATTGGGGAGCATAGGATGGCGG - Intergenic
1174129194 20:48329779-48329801 GCTGGGGAAGCACAGGAGGTGGG + Intergenic
1175785911 20:61711761-61711783 GCTTGGGTAGCACCGTGTGCGGG + Intronic
1177380657 21:20338454-20338476 GTTTGGGTAACACAGAAAGGAGG + Intergenic
1180126066 21:45791029-45791051 CCTTGGGATGCCCAGGATGGGGG + Intronic
1181638460 22:24185005-24185027 GCCTGGGCAGCCCAGGCTGGGGG + Intronic
1182583607 22:31329841-31329863 ACTTGGGTTTCACAGGAAGGAGG + Intronic
1183136406 22:35893088-35893110 GCTTGGGTAGCACTGCCTAGAGG - Intronic
1183143512 22:35967705-35967727 GCTTGGATAGCTGAGGATGGTGG - Intronic
1183683320 22:39347675-39347697 GCTTGGGAAGCTGAGGCTGGAGG - Intergenic
949240176 3:1861830-1861852 CTTTGAGTAGCACTGGATGGGGG - Intergenic
950910915 3:16590845-16590867 CCTAGGGCTGCACAGGATGGGGG + Intronic
950951142 3:17000583-17000605 GCTTGGGAAGGGCAGGAAGGAGG - Intronic
953143268 3:40249120-40249142 TCTTGAGTAGCACAGAATTGTGG + Intronic
954722630 3:52578494-52578516 GGTTGGGTAGGAGAGGATAGTGG - Intronic
956811166 3:72865435-72865457 ACTTGGGAAGCACAGGTGGGAGG - Intergenic
957080133 3:75630280-75630302 GCTTAGGAAGCAGGGGATGGTGG - Intergenic
958812823 3:98881219-98881241 GCTTTTGTAGCCCAGGCTGGAGG - Intronic
959551787 3:107668281-107668303 GCTTGGCTAGCACAGGAAAAAGG - Intronic
961165394 3:124760044-124760066 GCTGGGGGAGAACAGGATGCCGG + Intergenic
961740926 3:129032797-129032819 GCTGGGGAAGCACAGGATGTGGG - Intronic
962301147 3:134244211-134244233 GCTTGGGAAGAACATGCTGGTGG - Intronic
962454000 3:135548290-135548312 GCTAGGGTACCACAGCAAGGGGG + Intergenic
963742885 3:149097790-149097812 GCTCTGGCAGCACAGGATGGGGG + Intergenic
964040515 3:152255935-152255957 GCCTGGGTCTCAAAGGATGGTGG + Intronic
964569126 3:158094061-158094083 ATTTGGGGAGCAGAGGATGGGGG + Intergenic
968651510 4:1761973-1761995 AGCTGGGTGGCACAGGATGGAGG + Intergenic
968703741 4:2068856-2068878 GCTTGGGGAGCACAGGGGGTGGG + Exonic
968805346 4:2768363-2768385 GCTGGGGTTGAACAGGAAGGAGG - Intergenic
969656357 4:8501024-8501046 GCTTGGGAAGCACTGTATGAGGG + Intergenic
970234563 4:13945276-13945298 GATTTTATAGCACAGGATGGGGG + Intergenic
970725502 4:19039669-19039691 GATTAGGTAACAAAGGATGGTGG - Intergenic
970877207 4:20885092-20885114 GCTTGGGAAGCAGGGGAGGGAGG - Intronic
972943100 4:44221222-44221244 GCTTTGACAGCCCAGGATGGTGG + Intronic
972945404 4:44248430-44248452 GGTTGGGTAGGGCAGGATGGAGG - Intronic
973584119 4:52374174-52374196 GCCTGAGAAGCACAGGAGGGAGG - Intergenic
976656864 4:87497861-87497883 ACTTGGGAGGCACAGGAGGGAGG - Intronic
977960768 4:103082663-103082685 GCTTGGGAAGCTGAGGCTGGGGG - Intronic
978827128 4:113038895-113038917 GCTGGGGCAGCTCAGGCTGGAGG - Intronic
985450780 4:190060936-190060958 GCTTAGGAAGCAGGGGATGGTGG + Intergenic
985781834 5:1875685-1875707 GCATGGGTGGCGCAGGTTGGCGG - Intergenic
985819996 5:2153246-2153268 GCCTGGGGAGCCCAGGATGGTGG + Intergenic
987398218 5:17445925-17445947 GGCTGTGTAACACAGGATGGAGG - Intergenic
988677264 5:33445258-33445280 CCTGGGGCATCACAGGATGGAGG + Intronic
988700247 5:33666371-33666393 GCCTGTGTTCCACAGGATGGGGG + Intronic
989229364 5:39068806-39068828 GCTTGAATAACAGAGGATGGCGG + Intronic
989413781 5:41150376-41150398 GCTTGGTGAGCACAGGATCTGGG - Intronic
989601004 5:43200671-43200693 GCTTGTGTAGTACAGGCAGGAGG + Intronic
990751534 5:59021985-59022007 GCCCTGGTAGCAGAGGATGGTGG - Intronic
991240851 5:64458583-64458605 GCTTGGGTCCCAGAGGATTGGGG - Intergenic
994053015 5:95383264-95383286 GCTTGAGAAGCACAGGATGATGG + Intergenic
994639347 5:102386674-102386696 TCTTGTGTAACACAGGATTGGGG + Intronic
996541288 5:124632075-124632097 GCTTGGGTGTCAGAGGCTGGTGG - Intergenic
997726555 5:136125665-136125687 GCTTTGGCAGCATATGATGGGGG + Intergenic
997739388 5:136240274-136240296 ACTTGAGTAGCACAGGGAGGAGG - Intronic
998145689 5:139726843-139726865 GTCTGTGGAGCACAGGATGGTGG - Intergenic
998205003 5:140151775-140151797 GCTTGGGTAGAAGGGGAAGGAGG + Intergenic
1002736120 5:181387633-181387655 GGTGGGGTAGCTCAGGATGCTGG + Intergenic
1002748578 6:87191-87213 GGTGGGGTAGCTCAGGATGCTGG - Intergenic
1005962261 6:30702697-30702719 GATTGGGAAGCACTGGAGGGAGG + Intronic
1006630020 6:35424267-35424289 ACATGGGGAGCACAGGGTGGGGG + Intronic
1007731728 6:43951565-43951587 GCTTGGGTCGCACAGGAGATAGG + Intergenic
1009451037 6:63800905-63800927 GCATGGGTGGCTCAGGAAGGTGG + Intronic
1010100618 6:72102619-72102641 GCTTGGATGGGACAGGATGTTGG + Intronic
1010338602 6:74720885-74720907 ACATGGCTAGCACAGGAGGGTGG - Intergenic
1010821882 6:80423780-80423802 GCTTGGGTAAGAAAGAATGGAGG - Intergenic
1015629508 6:135217258-135217280 GCTTGGGTAGCTGAGGTAGGAGG + Intronic
1017186515 6:151606143-151606165 GCTTGGGCAGCACAGGTGGGTGG - Intronic
1018688112 6:166319142-166319164 TCTTGTGTAGCACTGGGTGGTGG - Intergenic
1018957438 6:168419657-168419679 CCTAGGGTAGCACAGGAAGGGGG - Intergenic
1019241217 6:170663161-170663183 GGTGGGGTAGCTCAGGATGCTGG + Intergenic
1019410361 7:904081-904103 GCCCGGGTGGCACAGGAGGGTGG - Intronic
1019450271 7:1094081-1094103 GCTTAGGTCGCACAGGCTGCTGG - Intronic
1019720852 7:2569670-2569692 TTTGGGGTAGCACAGGATGCCGG - Intronic
1022970662 7:35513938-35513960 TCTTGGATTGCACATGATGGGGG - Intergenic
1023129096 7:36984880-36984902 GCTTGGGTTGCAGAGAGTGGGGG - Intronic
1023812059 7:43919417-43919439 GCTGGGGTAGCGCAGGGTGATGG - Intronic
1024281348 7:47722171-47722193 GCTGGGGAAGCACAGGTTTGGGG - Intronic
1024426573 7:49232805-49232827 GCGAGGGTGGCACAAGATGGGGG - Intergenic
1026641024 7:72125756-72125778 ACTTGGGGAGGACAGGAAGGTGG - Intronic
1026941515 7:74290144-74290166 GCCTGGGGAGCACAGCCTGGTGG + Intronic
1027258124 7:76444258-76444280 GCTTGGGAAGCTGAGGCTGGAGG + Intergenic
1027280723 7:76607762-76607784 GCTTGGGAAGCTGAGGCTGGAGG - Intergenic
1029223194 7:99006490-99006512 GCTTGGTCAGCACAGAATGGTGG + Intronic
1030219981 7:107088376-107088398 GCCTGGGAAGTACAGGGTGGAGG + Intronic
1030549245 7:110937382-110937404 GTTTGGGTGGCACAGTTTGGGGG + Intronic
1030672854 7:112355763-112355785 GTCTGGGTTGCAGAGGATGGAGG + Intergenic
1032410856 7:131692519-131692541 GCTTGTGTAACACACGGTGGGGG + Intergenic
1032682921 7:134203888-134203910 GCTTGGGTAGCAAAGAATTAAGG - Intronic
1033149350 7:138899683-138899705 ACTTGGGTGGTGCAGGATGGGGG - Intronic
1033576137 7:142686660-142686682 TCTTGGCCAGGACAGGATGGAGG + Intergenic
1035506899 8:144934-144956 GGTGGGGTAGCTCAGGATGCTGG - Intergenic
1035688020 8:1539867-1539889 GCTTGGGGGGCACAGGAAGAAGG - Intronic
1039378921 8:37066816-37066838 GCTTGGGAAGAAGAGGATGGAGG + Intergenic
1039473607 8:37828031-37828053 GCTTGGGAGGCAGAGGTTGGAGG + Intronic
1043866154 8:85378101-85378123 GACTGGGTACCACAGGCTGGAGG + Exonic
1044534722 8:93345646-93345668 GCTAGGGTAGAAAAGGGTGGAGG - Intergenic
1044710368 8:95051551-95051573 GCTTGGCGAACACAGGATGATGG + Intronic
1045031544 8:98141373-98141395 GCTGGGGTGGCACAGGAGGTGGG + Intronic
1046932404 8:119854991-119855013 GCTGGGGCTGCACAGGGTGGAGG + Intronic
1047928902 8:129707017-129707039 GGCTGGGGAGCACAGAATGGGGG - Intergenic
1049389065 8:142358887-142358909 GCTGGGCCAGCGCAGGATGGGGG - Intronic
1052329729 9:27255131-27255153 GTTTGGGTATCAGAGGATGTTGG - Intergenic
1052813644 9:33083290-33083312 GCTTGGGTTGCAGACGGTGGGGG - Intergenic
1052889753 9:33687446-33687468 TCTTGGCTAGGACAGGATGGAGG + Intergenic
1055020177 9:71660954-71660976 GCTTGGGAAGCTCAGGTGGGAGG - Intergenic
1055501063 9:76902738-76902760 GCCTGGTTAGGACAGGCTGGGGG - Intronic
1056449794 9:86705863-86705885 GCTTGGGTAGCACAATATTTTGG - Intergenic
1058649519 9:107161778-107161800 GCTTTGGCTGCACAGGAAGGAGG - Intergenic
1059538398 9:115105971-115105993 GGTTGGATGGCACACGATGGGGG + Intronic
1060128979 9:121076717-121076739 GGGTGGGCAGCACAGAATGGGGG + Intronic
1061038705 9:128127621-128127643 GCGTGGGTAGCAGCGGCTGGGGG + Exonic
1061083736 9:128387199-128387221 GCTCTGGAAGCACAGGGTGGTGG + Intronic
1061149385 9:128820313-128820335 GCCTGGAGAGCTCAGGATGGAGG + Exonic
1061880151 9:133564880-133564902 TCTTGCGAGGCACAGGATGGAGG - Intronic
1062099594 9:134721273-134721295 GCCTGGGCAGCCCTGGATGGGGG - Intronic
1062243388 9:135551471-135551493 CCTGGGGCAGCTCAGGATGGGGG + Intergenic
1062291632 9:135797859-135797881 GCTTGGGAAGCAGAGGAAAGAGG - Intergenic
1203601408 Un_KI270748v1:12395-12417 GGTGGGGTAGCTCAGGATGCTGG + Intergenic
1186399061 X:9240234-9240256 GCTCGGGGAGCACAGAAAGGAGG + Intergenic
1186863380 X:13695022-13695044 GCTAGGGTAGCACAGGGATGTGG + Intronic
1187188277 X:17008916-17008938 GCTTGTGCAGCTGAGGATGGTGG - Intronic
1187445476 X:19356974-19356996 GTTTGGGTAGCAGAGGTTGTTGG + Intronic
1187717873 X:22121443-22121465 GCTTGTCGAGGACAGGATGGGGG + Intronic
1188242708 X:27809582-27809604 GCTCCGGTAGGACAGGAGGGGGG - Intronic
1190263866 X:48816141-48816163 GCTGGGGTACCTCAGGGTGGTGG - Exonic
1192557411 X:72101561-72101583 GCTTGGGGAGAAAAGGCTGGGGG - Intergenic
1195146064 X:102018470-102018492 GCTTGGGAAGCACCGAATGCGGG - Intergenic
1195939466 X:110156011-110156033 GCTTGGGAAGCAGAGGCAGGAGG - Intronic
1196725072 X:118888309-118888331 GGTTAGGTGCCACAGGATGGTGG - Intergenic
1197582362 X:128299180-128299202 GCATGAGTGGCACAGAATGGGGG - Intergenic
1199819666 X:151432346-151432368 GGTTGGGTGGGACAGGATGATGG - Intergenic
1200789411 Y:7286357-7286379 TGTTGGGTAACACAGGATGATGG + Intergenic