ID: 1072328112

View in Genome Browser
Species Human (GRCh38)
Location 10:94318582-94318604
Sequence AATTTCAGCTTGGGTAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328112_1072328115 -7 Left 1072328112 10:94318582-94318604 CCTGTGCTACCCAAGCTGAAATT 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1072328115 10:94318598-94318620 TGAAATTGTGTCCATCCTTGTGG No data
1072328112_1072328121 20 Left 1072328112 10:94318582-94318604 CCTGTGCTACCCAAGCTGAAATT 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data
1072328112_1072328118 16 Left 1072328112 10:94318582-94318604 CCTGTGCTACCCAAGCTGAAATT 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1072328118 10:94318621-94318643 ATCACCCACACTCAGCACCTTGG No data
1072328112_1072328123 26 Left 1072328112 10:94318582-94318604 CCTGTGCTACCCAAGCTGAAATT 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1072328123 10:94318631-94318653 CTCAGCACCTTGGGAGGAGCAGG No data
1072328112_1072328124 29 Left 1072328112 10:94318582-94318604 CCTGTGCTACCCAAGCTGAAATT 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1072328124 10:94318634-94318656 AGCACCTTGGGAGGAGCAGGAGG No data
1072328112_1072328119 17 Left 1072328112 10:94318582-94318604 CCTGTGCTACCCAAGCTGAAATT 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1072328119 10:94318622-94318644 TCACCCACACTCAGCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328112 Original CRISPR AATTTCAGCTTGGGTAGCAC AGG (reversed) Intronic
902607168 1:17575114-17575136 CATCTCAGCATGGGTAGCACTGG - Intronic
903446633 1:23426406-23426428 CATTTCAGCTTGGGTCGCAGAGG + Intergenic
905031998 1:34890982-34891004 TATTTTAGCTAAGGTAGCACTGG - Intronic
905446407 1:38030818-38030840 CATTCCAGCCTGGGTAGAACAGG + Intergenic
905938993 1:41848107-41848129 CATTTCAGCTGTGGTAGCTCTGG - Intronic
908237597 1:62161876-62161898 TATTTCATCTTGGGGATCACTGG - Exonic
908253994 1:62287451-62287473 AATTTCAGCATGGGTTAGACAGG - Intronic
908396835 1:63733018-63733040 AATTTCACCATGGGAAGCTCAGG + Intergenic
916066255 1:161138148-161138170 ATTTTCTGCTTGGGGAGCCCTGG + Intergenic
917200662 1:172510966-172510988 AAGATCAGCTTGGGTAACATGGG - Intergenic
918074308 1:181159027-181159049 AATTCCAGCCTGGGTACCAGGGG + Intergenic
920677366 1:208047587-208047609 AGTTTCAGCTTTGGGAGCAGTGG + Intronic
924705436 1:246497830-246497852 CATTACAGCCTGGGTAACACAGG + Intronic
1062845854 10:704426-704448 AACTACAGCATGGGCAGCACAGG - Intergenic
1064575510 10:16741956-16741978 CAGTTCAGTTTGGGGAGCACTGG - Intronic
1066466093 10:35651688-35651710 TGGTTCAGCTTGGGTAGCATAGG - Intergenic
1067661999 10:48243252-48243274 ACTTTCACCTTGGGAAGCACAGG + Intronic
1071161198 10:82746877-82746899 AATATCAGCCTGGGCAGCATAGG + Intronic
1072328112 10:94318582-94318604 AATTTCAGCTTGGGTAGCACAGG - Intronic
1072740322 10:97905235-97905257 AATTCCTGCCTGGGGAGCACAGG + Intronic
1073731350 10:106291917-106291939 AATTTCAGCTTGTGAGGCTCAGG + Intergenic
1073862021 10:107755846-107755868 AATTTCAAGATGGGTACCACAGG - Intergenic
1075387961 10:122070888-122070910 TATTCCAGCCTGGGTAGCAGAGG + Intronic
1076513331 10:131027701-131027723 AATTTCAGCTTATGTCTCACCGG - Intergenic
1079334691 11:19561118-19561140 AATTTCAGCTTGGGTCTCTAAGG + Intronic
1081846890 11:46247167-46247189 ATTTTCAGCTTGGCTTGCAGAGG - Intergenic
1083048523 11:59756645-59756667 CATTACAGTTTGGGAAGCACTGG + Intronic
1083313729 11:61801284-61801306 AATTTTAGGTTGGGAAGCAAAGG + Exonic
1087723651 11:101694693-101694715 AATTTCAACTTGGGTATCACTGG + Intronic
1088069056 11:105758208-105758230 CATTTCAGCCTGGGTGACACAGG + Intronic
1090058615 11:123444658-123444680 AATTTTAGCTTGGTTTACACAGG + Intergenic
1091328256 11:134708732-134708754 AATGTCAACTTGGGTGGAACTGG - Intergenic
1092621563 12:10276730-10276752 AATTTCACCTTGATTATCACTGG - Intergenic
1093055131 12:14548421-14548443 CATTCCAGCCTGGGTAACACAGG + Intronic
1093769560 12:23002981-23003003 AATCTCAGGTAGGCTAGCACAGG - Intergenic
1094291927 12:28860699-28860721 AAGTTAAGCTTGAGTAGAACAGG + Intergenic
1094301818 12:28972864-28972886 AATTTCATCTTTGGTATAACAGG - Intergenic
1096278623 12:50232401-50232423 AACTTCAGCCTGGGTAACAGAGG - Intronic
1100231237 12:92610333-92610355 AACTTCAGCTTGGGAAGGGCTGG - Intergenic
1100846180 12:98660310-98660332 TATTCCAGCTTGGGTGGCAGAGG + Intronic
1102190871 12:110987284-110987306 GATTTCACTTTGGGGAGCACTGG + Intergenic
1102340855 12:112120605-112120627 AAGATCAGCTTGGGCAACACAGG - Intergenic
1103295089 12:119879458-119879480 GAGATCAGCTTGGGTAGCATAGG - Intergenic
1104442156 12:128802468-128802490 AATTTCTGCTTGAGTTGCATAGG - Intronic
1108177692 13:47810229-47810251 AATTCCAGCTTGGTTAGGAAAGG + Intergenic
1108429733 13:50341657-50341679 AATTCCAGCATGGGAAGCAGGGG - Intronic
1116954535 14:50910654-50910676 AAGTTCAGCCTGGGCAGCATAGG - Intronic
1118216948 14:63817822-63817844 AAGATCAGCTTGGGCAACACAGG + Intergenic
1119358896 14:74031310-74031332 AAGATCAGCCTGGGTAACACAGG - Intronic
1119586504 14:75840727-75840749 AAATTAAGGTTGGGTAGCAGTGG - Intronic
1120320148 14:82949356-82949378 TATTGCAGTTTGGGTGGCACTGG + Intergenic
1120976620 14:90254482-90254504 AAGTTCAACTTGGGTCTCACAGG - Intergenic
1202847378 14_GL000009v2_random:192200-192222 AATTTCAGATTTGGTAGATCTGG + Intergenic
1202916845 14_GL000194v1_random:182758-182780 AATTTCAGATTTGGTAGATCTGG + Intergenic
1128166202 15:65467413-65467435 CATTACAGCTTGGGTAGCAGAGG - Intronic
1130045182 15:80438219-80438241 AATTGCAGCATGGTAAGCACAGG - Intronic
1130959651 15:88651379-88651401 AAGTTCAGCGTGGGTCTCACTGG + Intronic
1131202694 15:90413547-90413569 AATGTCAGCAAGGGTTGCACAGG + Intronic
1134407433 16:13973683-13973705 TGTTTCATCTTGGGTAGCCCTGG - Intergenic
1135880795 16:26254033-26254055 CATTGCAGCCTGGGTAACACAGG + Intergenic
1137321260 16:47385373-47385395 AACTTCAGATTGTGTACCACTGG - Intronic
1137862645 16:51861927-51861949 AATTTCAGTTTAGGAAGAACAGG - Intergenic
1140035409 16:71367859-71367881 GAATTCAGCTTGTGCAGCACAGG - Intronic
1140535040 16:75702127-75702149 AATTTCAGCCTGGGAAACGCAGG + Intronic
1142120594 16:88384684-88384706 AGTCTCAGCTTGGGAGGCACAGG + Intergenic
1146708231 17:35017888-35017910 AATCTCAGCTTGAGCACCACAGG + Intronic
1148492957 17:48034950-48034972 AACTTCAGCGTGGGCAGCAGAGG + Intronic
1149443614 17:56696488-56696510 AGTTTCAGCTTGAATAACACAGG + Intergenic
1151384718 17:73748010-73748032 AGTTTCTGGCTGGGTAGCACTGG + Intergenic
1154247544 18:12712976-12712998 ATTTTCAGTTCGGGTAGCATTGG + Intronic
1158215148 18:55093137-55093159 AACTGCAGCTGGGGAAGCACTGG + Intergenic
1202674720 1_KI270710v1_random:32372-32394 AATTTCAGATTTGGTAGATCTGG + Intergenic
925168243 2:1732697-1732719 AATTTCACTTTGGTGAGCACTGG - Intronic
925180050 2:1811702-1811724 AAAGACAGCTTGAGTAGCACAGG - Intronic
926092946 2:10062204-10062226 ACTTTCAGCCTGGGTAACATAGG - Intronic
926644223 2:15271517-15271539 AATTCCAGGTTGAGTAACACTGG + Intronic
930377209 2:50583082-50583104 AATTGCAGCCTGGGTAACAGCGG - Intronic
930900943 2:56507097-56507119 AAGATCAGCCTGGGTAACACAGG + Intergenic
938235917 2:129707473-129707495 AAGTTCAGCCTGGGCAACACAGG - Intergenic
940509002 2:154588708-154588730 AATCCCAGCTTTGGTAGCAATGG + Intergenic
940951298 2:159678205-159678227 TATTTCAGTTTGAGAAGCACAGG + Intergenic
944587429 2:201185073-201185095 CATTTGAGCCTGGGGAGCACAGG - Intronic
947537231 2:230947918-230947940 AGTTTCTGCTTAGGTAGGACAGG - Intronic
1171101780 20:22390484-22390506 AATTTCAGATTGGGCAGCTCAGG - Intergenic
1173034417 20:39395129-39395151 CATTCCAGCTTGGGCAGCAGAGG + Intergenic
1175473803 20:59254365-59254387 AATTTCAGATTCGGTTCCACTGG + Exonic
1176428050 21:6560762-6560784 ATGTTCAGCTTTGGTACCACGGG - Intergenic
1177358081 21:20034182-20034204 CACTCCAGCTTGGGCAGCACAGG - Intergenic
1177470517 21:21555376-21555398 ACTTTCAGCTTGGATATTACTGG + Intergenic
1179703541 21:43169079-43169101 ATGTTCAGCTTTGGTACCACGGG - Exonic
1184185887 22:42865058-42865080 TAATCCAGCTTGGGTAACACAGG - Intronic
1185303948 22:50101830-50101852 AATTTCATCTTGGGGATCCCAGG - Intronic
950920966 3:16694286-16694308 AGTTTTATCTTGGGTAGTACTGG - Intergenic
951393062 3:22130490-22130512 GATTTCCCCTTGGGTAGCGCTGG + Intronic
952841361 3:37648688-37648710 CATTTCAACTTGAGAAGCACAGG - Intronic
954608474 3:51931686-51931708 CACTTCAGCCTGGGTAACACTGG + Intergenic
955108100 3:55919723-55919745 AATTTTAGGTGGGGTAGCCCAGG + Intronic
955170948 3:56564851-56564873 AATTCCATCTTGAGTATCACGGG - Intronic
955323685 3:57993226-57993248 CATTCCAGCCTGGGTGGCACAGG + Intergenic
955453116 3:59091835-59091857 AAGACCAGCCTGGGTAGCACAGG - Intergenic
956354118 3:68371912-68371934 AATATCAGGTTGAGCAGCACTGG - Intronic
957103674 3:75859137-75859159 AATTTCAGATTTGGTAGATCTGG + Intergenic
963153384 3:142070478-142070500 AAGACCAGCTTGGGCAGCACAGG - Intronic
965024408 3:163282006-163282028 CATTTCAGCCTGGGTGACACAGG - Intergenic
965763007 3:172100110-172100132 AATTTCAGCTTTGGTATAAAAGG - Intronic
968197368 3:196718757-196718779 AGTTTCTGCTTGTGTAGCATTGG + Intronic
969874438 4:10125364-10125386 AATCTCATCTTAGGTAGTACGGG + Intergenic
970051262 4:11917395-11917417 AATTTAAGCTCGTGTAGAACTGG + Intergenic
971522392 4:27570212-27570234 AATTCCAAATTGGTTAGCACTGG - Intergenic
972124142 4:35741810-35741832 CATTGCAGCTTGGGTGGCATGGG - Intergenic
973559852 4:52124223-52124245 TATTTCTTCTTGGGTAGCATTGG + Intergenic
974808520 4:66915316-66915338 AAGTTCATCCTGGGAAGCACTGG - Intergenic
977465243 4:97376136-97376158 ACTTTCAGTTTGGGAGGCACAGG - Intronic
978944579 4:114480213-114480235 AAAGTCAGATTGGGTAGAACTGG + Intergenic
978998484 4:115185673-115185695 AAGCACAGATTGGGTAGCACTGG + Intergenic
986770412 5:10967744-10967766 AGTTTCTGATTGGGTAGGACTGG - Intergenic
988801924 5:34704025-34704047 AATTTCAGATTAGGTAGCTCTGG - Intronic
991041924 5:62185290-62185312 AAATTCAGCTTGATTTGCACTGG - Intergenic
991185298 5:63799778-63799800 AAGTTCAACATGGGTATCACTGG + Intergenic
992053209 5:72960386-72960408 AATTTCAGCTTGATTATCAATGG - Intronic
994302222 5:98159550-98159572 AATTTCAGTGTGGGTGGCAAAGG - Intergenic
995149552 5:108826450-108826472 AAGATCAGCCTGGGTAACACAGG - Intronic
1000816528 5:165929477-165929499 AAGTTCTGTTTGGGTAGCAAAGG - Intergenic
1002373535 5:178772854-178772876 AGTTTCAGCTTTGGCAGGACAGG + Intergenic
1002761445 6:205594-205616 AATATCAGCTTGGATCGCCCTGG + Intergenic
1004644377 6:17545284-17545306 AAATTAAGCTTAGGTAGCAATGG + Intronic
1005476772 6:26215619-26215641 AATTCCAGCCTGGGCAACACTGG - Intergenic
1009280815 6:61748861-61748883 AATATCATATTGGATAGCACAGG - Intronic
1009935278 6:70226769-70226791 AAATTCAGCTTGGGGAGAACTGG - Intronic
1014920374 6:127207763-127207785 AATGTCGGGTTGGGTATCACAGG + Intergenic
1016264868 6:142220995-142221017 AGTTTCTGATTGGGTAGGACAGG - Exonic
1016472704 6:144391269-144391291 AAGATCAGCCTGGGTAACACAGG - Intronic
1017543140 6:155423457-155423479 AATTAGGCCTTGGGTAGCACTGG + Intronic
1017897983 6:158698057-158698079 AATTTGAGCTAAGATAGCACTGG - Intronic
1018811872 6:167304272-167304294 AAACTCAGCTATGGTAGCACTGG - Intronic
1023496710 7:40805648-40805670 AATGTCAGCTTGGGTTGAAGTGG - Intronic
1023735960 7:43236062-43236084 TATATCACATTGGGTAGCACAGG - Intronic
1030613710 7:111716208-111716230 AATCTCAGCCTGGGAAGCAGGGG - Intergenic
1031391198 7:121217088-121217110 CATTCCAGCTTGGGTGGCAGAGG - Intronic
1032524974 7:132573168-132573190 AGTTTCACATTGGGTAGCACTGG + Intronic
1032585562 7:133143052-133143074 AAATGCAGCTGGGGTATCACAGG - Intergenic
1033597368 7:142867159-142867181 AACTTCTGGTTGGGAAGCACGGG - Intronic
1034846820 7:154454142-154454164 CATTTCATCATGGGAAGCACAGG + Intronic
1036564951 8:9930711-9930733 AATTCCAGCCTGGGTAACAGAGG - Intergenic
1038803556 8:30770740-30770762 AAATTCAGCTGGGTAAGCACTGG - Intergenic
1039028286 8:33282127-33282149 AATTTCAGTTTTGGTGACACTGG - Intergenic
1041483795 8:58351835-58351857 AATTTCAGGGTGGGGAGCAAAGG + Intergenic
1041516459 8:58704367-58704389 AACTTCAGCCTGGGTAACAGAGG + Intergenic
1044017336 8:87059927-87059949 GCTTTCAGCTTTGTTAGCACAGG - Intronic
1044551394 8:93516576-93516598 ACTTTCTGCTGGGGTAGCAGTGG + Intergenic
1044922610 8:97181778-97181800 AGTTTCAGCTTGGGAGGCAATGG + Intergenic
1046810349 8:118526432-118526454 AAATTCTGCTTTGGTAGCTCTGG + Intronic
1048592339 8:135832407-135832429 AATTTAAGCTCTGGCAGCACTGG - Intergenic
1048880460 8:138868316-138868338 AAATTCAGTTTGGGTAGGAGTGG + Intronic
1049738902 8:144225366-144225388 AAGATCAGCCTGGGTAACACAGG - Intronic
1050652545 9:7789819-7789841 AATTGCAGCTGGGGTTGCTCGGG - Intergenic
1053410048 9:37910067-37910089 CACTTCAGCTTGGGCAACACAGG - Intronic
1059527444 9:115005670-115005692 AAATCCAGCTTGGAAAGCACTGG + Intergenic
1059733755 9:117081634-117081656 AAGTTCATCTTGGGTAGGCCTGG + Intronic
1059997414 9:119925515-119925537 ATTTTCAGATTGAGTAGCAATGG - Intergenic
1060319555 9:122543854-122543876 ACTTTCAGTTTGGGCAGAACTGG - Intergenic
1061475812 9:130865443-130865465 AATTTCAGCTTCTATAGCAAAGG - Intronic
1203652533 Un_KI270751v1:140992-141014 AATTTCAGATTTGGTAGATCTGG + Intergenic
1185945051 X:4366027-4366049 AATTGCAGCTTGGGATGCAAAGG - Intergenic
1187160697 X:16762826-16762848 ATTTACAGTTTGGGAAGCACTGG + Exonic
1196714887 X:118800987-118801009 AACATCAGCTTGGGCAACACAGG - Intergenic
1199247605 X:145625138-145625160 AACTTCAGCTTGGGCAGCCAAGG + Intergenic
1200154074 X:153966006-153966028 ACTCCCAGCCTGGGTAGCACAGG + Intronic
1201172470 Y:11282149-11282171 AATTTCAGATTTGGTAGATCTGG + Intergenic
1201922192 Y:19245596-19245618 AATTTAAGCTTGAGCATCACAGG - Intergenic