ID: 1072328113

View in Genome Browser
Species Human (GRCh38)
Location 10:94318591-94318613
Sequence GATGGACACAATTTCAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328113_1072328123 17 Left 1072328113 10:94318591-94318613 CCCAAGCTGAAATTGTGTCCATC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1072328123 10:94318631-94318653 CTCAGCACCTTGGGAGGAGCAGG No data
1072328113_1072328127 27 Left 1072328113 10:94318591-94318613 CCCAAGCTGAAATTGTGTCCATC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1072328127 10:94318641-94318663 TGGGAGGAGCAGGAGGCAGTGGG No data
1072328113_1072328118 7 Left 1072328113 10:94318591-94318613 CCCAAGCTGAAATTGTGTCCATC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1072328118 10:94318621-94318643 ATCACCCACACTCAGCACCTTGG No data
1072328113_1072328119 8 Left 1072328113 10:94318591-94318613 CCCAAGCTGAAATTGTGTCCATC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1072328119 10:94318622-94318644 TCACCCACACTCAGCACCTTGGG No data
1072328113_1072328124 20 Left 1072328113 10:94318591-94318613 CCCAAGCTGAAATTGTGTCCATC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1072328124 10:94318634-94318656 AGCACCTTGGGAGGAGCAGGAGG No data
1072328113_1072328126 26 Left 1072328113 10:94318591-94318613 CCCAAGCTGAAATTGTGTCCATC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1072328126 10:94318640-94318662 TTGGGAGGAGCAGGAGGCAGTGG No data
1072328113_1072328121 11 Left 1072328113 10:94318591-94318613 CCCAAGCTGAAATTGTGTCCATC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328113 Original CRISPR GATGGACACAATTTCAGCTT GGG (reversed) Intronic
900849136 1:5128344-5128366 GATGGGCACAATTGCAGCCAGGG - Intergenic
902846886 1:19117933-19117955 CATGAACACATTTTCATCTTAGG + Intronic
903581775 1:24376501-24376523 GAAGGACACAATTCTATCTTGGG + Intronic
904013562 1:27404037-27404059 GCTGGAAACCATTTCAGTTTAGG - Intergenic
905241019 1:36581615-36581637 GATGTACAAAATATGAGCTTTGG - Intergenic
910920243 1:92338365-92338387 CATGCAGACAAGTTCAGCTTTGG - Intronic
913233706 1:116762895-116762917 GGTGGCCACAATTTTATCTTGGG - Intronic
914325113 1:146606051-146606073 TATGAACTCAATTTTAGCTTGGG + Intergenic
920344966 1:205300535-205300557 GATGGAAAGAATTGCATCTTCGG - Intergenic
920540704 1:206775848-206775870 GATGGATAGAATGTCAGCCTGGG + Intergenic
921142073 1:212318075-212318097 GAAAGGCACAATTTCATCTTTGG - Intronic
921423459 1:214975346-214975368 AATGGACACAATTTCAGCCCAGG + Intergenic
921633880 1:217468282-217468304 GAAGTACACAATATCACCTTTGG + Intronic
922772037 1:228190758-228190780 GATGGGAACAATTTCAGGCTGGG - Intergenic
1064513800 10:16124382-16124404 GAGGAACACAAGTTGAGCTTGGG - Intergenic
1064794467 10:18995916-18995938 TATTGCCACAATTTCAGCTCCGG - Intergenic
1065770070 10:29069840-29069862 GATGGACACAATTTAGGCTGGGG + Intergenic
1066078580 10:31906499-31906521 GATGGAAACGACTTCAGCTTTGG - Intronic
1067971875 10:50980930-50980952 GAGGTTCACAGTTTCAGCTTGGG + Intergenic
1068412836 10:56679706-56679728 GTAGGTCACCATTTCAGCTTTGG - Intergenic
1068819836 10:61361755-61361777 GAAGGACAAAATTTCTGCTCTGG - Intergenic
1072243507 10:93520105-93520127 GATAAACACAATTTCAGTTCAGG - Intronic
1072328113 10:94318591-94318613 GATGGACACAATTTCAGCTTGGG - Intronic
1072688553 10:97554142-97554164 CATGGACACAGTTACAGCTCAGG + Intronic
1073164146 10:101429225-101429247 GATGGATAAAATTTCATCCTGGG + Intronic
1073827847 10:107345935-107345957 GACTGATACAGTTTCAGCTTTGG - Intergenic
1073907975 10:108306376-108306398 GATAGACACAAGATCAGTTTGGG - Intergenic
1074439270 10:113460818-113460840 CAAGGACACAGGTTCAGCTTTGG - Intergenic
1076121856 10:127942743-127942765 GAGGGACAGAGTTTCAGTTTGGG + Intronic
1078241272 11:9532724-9532746 AATGGGTACAATTTCAGTTTGGG - Intergenic
1079160168 11:17984943-17984965 GATGTACACAATTACAAATTGGG + Intronic
1081643397 11:44773774-44773796 GATGGACACAAGACCAGCCTGGG + Intronic
1082897330 11:58205671-58205693 ATTGGAAATAATTTCAGCTTGGG + Intergenic
1084874412 11:72120232-72120254 AATGGATACAGTTTCAGCTGGGG + Intronic
1085378565 11:76090829-76090851 TATTCACACAATTTCATCTTTGG + Intronic
1087072240 11:94092436-94092458 GATGCACACATTTTCAGCTGAGG + Intronic
1087189556 11:95238450-95238472 GATGGACATACCTTTAGCTTGGG - Intergenic
1090346486 11:126075811-126075833 GATGGACAAAACTTAAACTTGGG + Intergenic
1091791124 12:3272778-3272800 GAGGGACACAATTCCCCCTTCGG - Intronic
1091908711 12:4211438-4211460 GATGGACATAACTTAAGCTTTGG - Intergenic
1092606909 12:10130451-10130473 GATGCAAACTATTTCAGTTTTGG + Intergenic
1093152523 12:15639730-15639752 TATGACCACAATTCCAGCTTTGG + Intronic
1097322455 12:58241309-58241331 GATGGCAACAGGTTCAGCTTTGG - Intergenic
1100419892 12:94422926-94422948 TGTGGACACATTTTCAGTTTGGG + Intronic
1100708688 12:97229986-97230008 GATGCTCACATTTTCAGCTAAGG - Intergenic
1102947687 12:117004450-117004472 GAGGGAAACAATTTCAACTCAGG - Intronic
1103470150 12:121173874-121173896 GATGTAAACAACTTCAGCCTTGG + Intronic
1103483515 12:121266821-121266843 GCTGGGCAAAATGTCAGCTTGGG - Intronic
1104913373 12:132251224-132251246 GATCGATACAATTTTAACTTTGG + Intronic
1106461984 13:29979088-29979110 GATGGACCCAATCACAGCCTTGG - Intergenic
1109306563 13:60648070-60648092 TACAGACACAATGTCAGCTTGGG + Intergenic
1110197375 13:72805615-72805637 GTTGGATACAATATAAGCTTTGG + Intronic
1110212255 13:72987484-72987506 GATACACACAATTTCAGGTTTGG - Intronic
1111895551 13:94137340-94137362 GCTGGACAAAATTTCACCCTGGG - Intronic
1113990634 14:16024771-16024793 AAAGGACACAATTTCAGCAAAGG - Intergenic
1115737525 14:36349785-36349807 GATGGACACAAATTCTAGTTTGG + Intergenic
1117816418 14:59603524-59603546 GATGGATTCATTTTCATCTTGGG - Intronic
1118117414 14:62796149-62796171 GATTGACACAATTATACCTTAGG + Intronic
1126190366 15:45872298-45872320 GAAGGACACAATTACAGAATTGG + Intergenic
1128670221 15:69569096-69569118 GATGGAAACAATTCTAGCTCTGG + Intergenic
1138010599 16:53375795-53375817 GGTCTACACAATTTCACCTTTGG + Intergenic
1140008452 16:71104896-71104918 TATGAACTCAATTTTAGCTTGGG - Intronic
1141979046 16:87538299-87538321 GATGGAAACAATTTAGACTTGGG - Intergenic
1146797470 17:35793255-35793277 GATGGAGAGAATTTCATCTTGGG - Intronic
1152182142 17:78829229-78829251 GATGGTGAGAGTTTCAGCTTTGG - Intronic
1153041126 18:813203-813225 GACGGACACGATTCCAGCTGTGG - Intergenic
1153427722 18:4985294-4985316 TATGTACACAATTTCTGTTTCGG - Intergenic
1159118856 18:64146289-64146311 GATGGTCACACTGTCATCTTTGG - Intergenic
1160610355 18:80079701-80079723 GATGAACACAAATGCAGCTGTGG + Intronic
1162191303 19:8949131-8949153 GATGGCCAGTATTTCAGCTGAGG + Exonic
1163801372 19:19367830-19367852 GCTGGACAACATTCCAGCTTCGG + Intergenic
1164234081 19:23316957-23316979 GACGGAAACAATTCCAGCTGTGG - Intronic
1164234084 19:23316988-23317010 GACGGAAACAATTCCAGCTGTGG - Intronic
1164886471 19:31782776-31782798 AATGGAGAAAACTTCAGCTTTGG + Intergenic
1167092263 19:47352771-47352793 GATGGACACAAGTTCATTCTGGG - Exonic
1168181673 19:54666208-54666230 GATGGACAGAGTCTCAGCTCTGG - Intronic
925159645 2:1675108-1675130 GATGGAAGCAATGTCAGCTTAGG + Intronic
929468897 2:42170666-42170688 GAGAGAAACAGTTTCAGCTTTGG + Intronic
930372771 2:50524935-50524957 GATGGTCTCAATTTCAAGTTTGG - Intronic
931814488 2:65887467-65887489 AATGCAAACCATTTCAGCTTGGG - Intergenic
932057714 2:68462932-68462954 GAAGTACAGGATTTCAGCTTGGG + Exonic
932363146 2:71126610-71126632 GGTCTACACAATTTCACCTTTGG - Intronic
937338288 2:121075429-121075451 AATGGACTCATTTTCAGCTGAGG + Intergenic
938736481 2:134191055-134191077 GAGGGACACAGTTTCGGCTTGGG - Intronic
941717833 2:168782321-168782343 GATGCACACATTCTCAGCTGCGG - Intergenic
943433325 2:187831565-187831587 GAAGGACACAATTTCATTTATGG - Intergenic
943478421 2:188387551-188387573 AATGGTAACACTTTCAGCTTGGG + Intronic
943496168 2:188623406-188623428 AATGCACACAACTTAAGCTTGGG - Intergenic
943953827 2:194161517-194161539 GATAGACATCATTTCAGCCTAGG + Intergenic
947712566 2:232324466-232324488 AATGGACTAATTTTCAGCTTTGG + Intronic
947731530 2:232434146-232434168 AATGGACACATTTTCAGCTTTGG + Intergenic
1169696721 20:8396738-8396760 GATGAACACAGTTTGATCTTTGG - Intronic
1170332366 20:15227637-15227659 GATTTCCACAATTTCACCTTTGG - Intronic
1170815053 20:19706794-19706816 GATGGCAACAAGTTCAGCTACGG + Intronic
1173449158 20:43147187-43147209 GGAGGACACAGTTTCATCTTGGG - Intronic
1173803471 20:45909626-45909648 GATGGACACACCCTCAGCTGAGG + Exonic
1173997908 20:47353584-47353606 GATGGATTCACTTTCTGCTTTGG - Intronic
1177374201 21:20248012-20248034 GCTGGCCACAACTTTAGCTTGGG - Intergenic
1177974297 21:27827945-27827967 GATGCACAAAATTTGACCTTGGG + Intergenic
1181593816 22:23901023-23901045 CATGGACACAATATCAGACTGGG + Intergenic
1181894677 22:26096571-26096593 GATTGAGACAATTTTAGATTGGG + Intergenic
949424269 3:3899550-3899572 TATGGTCAAAATATCAGCTTGGG - Intronic
949818419 3:8087824-8087846 GATGGAAATAATTTGAGTTTTGG + Intergenic
952921520 3:38288058-38288080 TAGGTACAGAATTTCAGCTTGGG - Intronic
955167498 3:56528801-56528823 GAATGACACAATTTCAGGGTTGG - Intergenic
957759469 3:84536721-84536743 GATGCAAACATTTTCATCTTAGG - Intergenic
958673709 3:97238078-97238100 CATGTACATAATTTTAGCTTGGG - Intronic
961201268 3:125047662-125047684 GATGGAAACAGCTTCAACTTGGG - Intronic
962594708 3:136928919-136928941 GAGGGACAGAATTTCATTTTTGG + Intronic
962727008 3:138239175-138239197 GATGGACACATTTTGAGGCTAGG - Intronic
964251804 3:154726749-154726771 GTGGGACACAATTCCAGATTTGG - Intergenic
964825159 3:160817809-160817831 GAAGGAGGCAAGTTCAGCTTTGG + Intronic
965053759 3:163687779-163687801 GATGGACACAGTTCAAGATTTGG - Intergenic
965642175 3:170840758-170840780 GATGGACATCTGTTCAGCTTGGG - Intronic
966043123 3:175516666-175516688 AATGGACACAATTTGAACTATGG + Intronic
967073014 3:185978660-185978682 GATGGGCTCCATTTCTGCTTGGG + Intergenic
967429521 3:189365698-189365720 AATTGACAGAATTTTAGCTTTGG + Intergenic
971146489 4:23982275-23982297 AATGGACAGCATTTCAGCCTAGG - Intergenic
971174452 4:24267353-24267375 CATGGAAACAATCTCTGCTTTGG - Intergenic
971520534 4:27545301-27545323 TATGGAAACAATTTAATCTTTGG - Intergenic
971911398 4:32800776-32800798 AATGGACACAAGTTCAATTTGGG - Intergenic
973682205 4:53332078-53332100 TATTGCCACAATTTCAGCTCCGG - Intronic
975828625 4:78345835-78345857 GAAGGACTCAATTTAAGCATAGG - Intronic
977844195 4:101747094-101747116 GATGGATTCAATTTCTGTTTAGG + Intronic
978823670 4:112994351-112994373 GATGGACACAATTCCTTCATTGG + Intronic
979577820 4:122316375-122316397 GATGGCCACAAACTCACCTTTGG + Intronic
982911969 4:161153535-161153557 AATGTACACATTTCCAGCTTTGG - Intergenic
984627635 4:182025405-182025427 GATGGACACATCAACAGCTTTGG + Intergenic
985710667 5:1426813-1426835 TGGGGACAAAATTTCAGCTTTGG + Intronic
986640817 5:9870237-9870259 GATTCACACATTTACAGCTTTGG + Intergenic
991278540 5:64882324-64882346 GAAGGAGACGATTTCAGGTTTGG + Intronic
993078083 5:83260817-83260839 GATGTAAACCATATCAGCTTTGG + Intronic
995287124 5:110402613-110402635 GATGGGAACAAGTACAGCTTAGG + Intronic
998213703 5:140221333-140221355 CAGGGACACAGTTTCAGTTTGGG - Intronic
998892520 5:146761689-146761711 CATGGCCAAAATTTCAGCTCAGG - Intronic
999365947 5:151023501-151023523 TCTGGGCACAGTTTCAGCTTGGG - Intronic
999626174 5:153522618-153522640 GATGGTCCCTCTTTCAGCTTGGG - Intronic
1000892535 5:166816587-166816609 GCTGGAAACAATTCCAGCTATGG + Intergenic
1001849976 5:174955317-174955339 AATGGGCACAGTTTCAGTTTTGG - Intergenic
1002682879 5:180981909-180981931 GCTGGACACTAATTCAGCTGAGG - Intergenic
1002772956 6:304813-304835 AAGGGACACAGTTTCAGTTTGGG - Intronic
1004280904 6:14278734-14278756 GATGGGCACAAATGCAGCTTAGG + Intergenic
1011875282 6:91952386-91952408 AATGGACAAAATTTAAGCCTTGG + Intergenic
1014912365 6:127110406-127110428 GTGGGACAAATTTTCAGCTTTGG - Intergenic
1017392148 6:153952664-153952686 GACGAACACAATGGCAGCTTTGG + Intergenic
1018753472 6:166828112-166828134 GATGGAGACAATTACACCTCAGG + Intronic
1019794867 7:3042166-3042188 GGGGGACACAGTTTCAGTTTGGG + Intronic
1019811842 7:3170698-3170720 GATTGACCGAATTTCAGATTTGG - Intronic
1021517876 7:21507091-21507113 GATGGACATCATTTCAGCCCAGG + Intronic
1028704603 7:93825051-93825073 GATGTAAAGAATTTCAGCTTTGG - Intronic
1029925469 7:104311569-104311591 GATGGACACAATGTAAGAGTTGG + Intergenic
1033907257 7:146220414-146220436 GAAGGACACAAGCTCAGATTTGG + Intronic
1037098471 8:15014704-15014726 CATGGAAACACCTTCAGCTTTGG - Intronic
1038254936 8:25942484-25942506 AATGGACACAATGTCCCCTTGGG + Intronic
1042634962 8:70864207-70864229 AATGTAAACAATTTCAACTTAGG + Intergenic
1043981394 8:86644503-86644525 AAAGGATATAATTTCAGCTTTGG - Intronic
1046027147 8:108738696-108738718 GATAGAATTAATTTCAGCTTTGG + Intronic
1047998969 8:130361045-130361067 GCTGGAAACAATTTCAGACTTGG + Intronic
1048955993 8:139536438-139536460 GAAGGACAAACTTTAAGCTTTGG + Intergenic
1056560406 9:87724789-87724811 AATGGATACAGTTTCAGTTTAGG + Intergenic
1062400091 9:136368583-136368605 AATGGACACCATTGCTGCTTCGG - Intronic
1187940743 X:24378394-24378416 CATGGATATAATTTTAGCTTTGG - Intergenic
1188364299 X:29295736-29295758 GATGGACAGAGTTTCATCTTGGG - Intronic
1188759461 X:34008655-34008677 ATTGCACACAATTTCAGCTCTGG + Intergenic
1193608847 X:83603553-83603575 GTTGGACACAATGCCAGATTTGG + Intergenic
1193980511 X:88176279-88176301 GATGTGCACAACTCCAGCTTGGG + Intergenic
1198690564 X:139279671-139279693 GAGGGACACTATTACAGCTGAGG - Intergenic
1198978773 X:142369179-142369201 GATGTGCACATTTTCAGCTGAGG + Intergenic
1199710713 X:150467215-150467237 AAGAGACACAATTTCAGTTTGGG + Intronic
1200204886 X:154308702-154308724 GAGGGCCACATTTTCTGCTTGGG + Intronic
1200710590 Y:6481466-6481488 GGAGGACCCACTTTCAGCTTTGG - Intergenic
1200844391 Y:7816521-7816543 TATGGACACAATATCACCTGTGG + Intergenic
1200980760 Y:9261398-9261420 ACTGGACACAATTTCAGACTTGG + Intergenic
1201023342 Y:9680518-9680540 GGAGGACCCACTTTCAGCTTTGG + Intergenic