ID: 1072328114

View in Genome Browser
Species Human (GRCh38)
Location 10:94318592-94318614
Sequence GGATGGACACAATTTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328114_1072328127 26 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328127 10:94318641-94318663 TGGGAGGAGCAGGAGGCAGTGGG No data
1072328114_1072328128 30 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data
1072328114_1072328126 25 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328126 10:94318640-94318662 TTGGGAGGAGCAGGAGGCAGTGG No data
1072328114_1072328123 16 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328123 10:94318631-94318653 CTCAGCACCTTGGGAGGAGCAGG No data
1072328114_1072328121 10 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data
1072328114_1072328124 19 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328124 10:94318634-94318656 AGCACCTTGGGAGGAGCAGGAGG No data
1072328114_1072328118 6 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328118 10:94318621-94318643 ATCACCCACACTCAGCACCTTGG No data
1072328114_1072328119 7 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328119 10:94318622-94318644 TCACCCACACTCAGCACCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328114 Original CRISPR GGATGGACACAATTTCAGCT TGG (reversed) Intronic
900440253 1:2651397-2651419 GGATTGTCACAAGTTCACCTGGG - Intronic
900849137 1:5128345-5128367 TGATGGGCACAATTGCAGCCAGG - Intergenic
903808297 1:26020895-26020917 GGATGGGCATAATGTCAGCCAGG - Intronic
904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG + Intergenic
907990101 1:59572525-59572547 GGATGGAAATAATTCCAGTTTGG + Intronic
911233698 1:95386908-95386930 GGATGGACTCCATTTCAACCAGG - Intergenic
913233707 1:116762896-116762918 GGGTGGCCACAATTTTATCTTGG - Intronic
917363778 1:174205938-174205960 GGATGGGGACAATTGGAGCTAGG + Intronic
919755351 1:201062827-201062849 GGATGGACATGAGTGCAGCTTGG + Intronic
920540703 1:206775847-206775869 GGATGGATAGAATGTCAGCCTGG + Intergenic
922480471 1:225937164-225937186 CAATGCACACATTTTCAGCTGGG - Exonic
922491035 1:226016988-226017010 TGCTGGACACAAATTCAACTGGG - Intergenic
1064513801 10:16124383-16124405 GGAGGAACACAAGTTGAGCTTGG - Intergenic
1065770069 10:29069839-29069861 GGATGGACACAATTTAGGCTGGG + Intergenic
1068359755 10:55962031-55962053 GAGTGGACAGAATTTCAGCTGGG - Intergenic
1068843894 10:61648759-61648781 AAATGGACAAAAGTTCAGCTGGG - Intergenic
1070310887 10:75273045-75273067 GCCTGGACACAGTTTCGGCTGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072900865 10:99405211-99405233 GAATATACACACTTTCAGCTAGG + Intronic
1073907976 10:108306377-108306399 GGATAGACACAAGATCAGTTTGG - Intergenic
1075706883 10:124507186-124507208 GGATAGACAGGATTTCAGGTGGG + Intronic
1081643396 11:44773773-44773795 GGATGGACACAAGACCAGCCTGG + Intronic
1082860555 11:57851642-57851664 GGATGAAGCCAATTTCATCTTGG - Intergenic
1084874411 11:72120231-72120253 TAATGGATACAGTTTCAGCTGGG + Intronic
1086119952 11:83295304-83295326 GGGTGGGAACAATTTCAGCAAGG - Intergenic
1087232702 11:95683992-95684014 GGCTGGCCTCACTTTCAGCTGGG - Intergenic
1090346485 11:126075810-126075832 GGATGGACAAAACTTAAACTTGG + Intergenic
1098426746 12:70372892-70372914 GGATGAACAGAGTTTCATCTTGG + Intronic
1103188992 12:118984332-118984354 GCATTGGCACAATATCAGCTGGG + Intronic
1106311654 13:28560016-28560038 GGATGAACACAATATGGGCTGGG - Intergenic
1107988118 13:45793399-45793421 GGATGAACACAACTTAATCTGGG - Intronic
1108248497 13:48541590-48541612 GGAAGGACACAATACCATCTAGG - Intergenic
1109306562 13:60648069-60648091 GTACAGACACAATGTCAGCTTGG + Intergenic
1109869921 13:68321253-68321275 GCATGGACTCACTTTCAGCAGGG + Intergenic
1111200983 13:84936820-84936842 GCATGAACACAGTTTCTGCTTGG + Intergenic
1112245329 13:97728299-97728321 GGCTTGCCACAATTTCAGCCAGG - Intergenic
1117816419 14:59603525-59603547 GGATGGATTCATTTTCATCTTGG - Intronic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1121849200 14:97204016-97204038 GGAGGGACAGGATTTCAGGTAGG - Intergenic
1122742816 14:103881753-103881775 GGAAGGCCCCAAGTTCAGCTAGG - Intergenic
1127707356 15:61560393-61560415 GGATGGACAGAAGTTCAGGTAGG + Intergenic
1128813543 15:70588697-70588719 GGAAGGAGACTATTTTAGCTGGG - Intergenic
1128836151 15:70810660-70810682 GGATGGTCTCAATTTTTGCTGGG + Intergenic
1135129856 16:19844399-19844421 AGTTGAACCCAATTTCAGCTGGG + Intronic
1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG + Intronic
1140579967 16:76218431-76218453 GATTGGACAAAATTTCAGTTAGG - Intergenic
1141739057 16:85878176-85878198 GAAAGCACACACTTTCAGCTGGG + Intergenic
1146644082 17:34564932-34564954 GACTGGACTCAAGTTCAGCTTGG - Intergenic
1146797471 17:35793256-35793278 AGATGGAGAGAATTTCATCTTGG - Intronic
1151082300 17:71342917-71342939 GAATGGACAATATTTCATCTTGG + Intergenic
1155571717 18:27202015-27202037 GGATTAAAACAATGTCAGCTGGG + Intergenic
1156285430 18:35689977-35689999 GGTTGGACTCAATATCACCTTGG + Intronic
1157380384 18:47209574-47209596 GGATGGAAACAAAATCAGCATGG + Intergenic
1166704678 19:44902162-44902184 GGATGGACAAAGCTCCAGCTTGG - Intronic
1167092264 19:47352772-47352794 GGATGGACACAAGTTCATTCTGG - Exonic
1167814308 19:51866243-51866265 GAACTGACACACTTTCAGCTCGG + Intronic
925157593 2:1659293-1659315 GGCTGAAAAGAATTTCAGCTAGG + Intronic
927417754 2:22896583-22896605 GGATAAACATAATTTAAGCTAGG - Intergenic
928375466 2:30769901-30769923 GGATGGGCAGGATTTCAGCAAGG - Intronic
929797999 2:45075011-45075033 GGAGGCAAACAACTTCAGCTGGG + Intergenic
933498002 2:83075735-83075757 AGATGGACACAAATGCAGATAGG - Intergenic
933786331 2:85845606-85845628 GGATTGACACAACTGCAGCAGGG + Intronic
938736482 2:134191056-134191078 GGAGGGACACAGTTTCGGCTTGG - Intronic
939733263 2:145811593-145811615 GGATGGAGACATTTGCAGTTAGG - Intergenic
943709534 2:191075549-191075571 GGAATGACAGAAATTCAGCTTGG + Intronic
944143421 2:196481246-196481268 GGAATGTCACAATTTTAGCTTGG + Intronic
944395325 2:199260024-199260046 GGATCGACATTATTTCACCTTGG + Intergenic
945157511 2:206855149-206855171 GAATGGGCACAGTTTCAGTTTGG + Intergenic
1168900129 20:1356771-1356793 GGATGGACACAATGGCAGAGTGG - Intronic
1172201131 20:33126700-33126722 GGATGGTCACAGTCACAGCTCGG + Intergenic
1176892541 21:14335633-14335655 TGATGGAAACAATTTCAACCAGG + Intergenic
1177374202 21:20248013-20248035 GGCTGGCCACAACTTTAGCTTGG - Intergenic
952921521 3:38288059-38288081 GTAGGTACAGAATTTCAGCTTGG - Intronic
955521860 3:59783107-59783129 GGATGGAAACAAATTCCTCTGGG - Intronic
956322570 3:68014088-68014110 GAATGTACACAGATTCAGCTTGG - Intronic
958673710 3:97238079-97238101 GCATGTACATAATTTTAGCTTGG - Intronic
961405485 3:126676830-126676852 GGATGGACTCACTTTCTTCTTGG - Intergenic
965961885 3:174439438-174439460 GAATGGAAGGAATTTCAGCTAGG - Intronic
966240736 3:177752941-177752963 GCATGGACAGAATTACTGCTGGG - Intergenic
966903982 3:184508553-184508575 GGTTAGACACAATTCCAGCAGGG + Intronic
967073013 3:185978659-185978681 GGATGGGCTCCATTTCTGCTTGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970159208 4:13172210-13172232 GGATGTCCACAAATTCAACTGGG + Intergenic
971911399 4:32800777-32800799 GAATGGACACAAGTTCAATTTGG - Intergenic
972338146 4:38127140-38127162 GGAGGTAAACAATGTCAGCTGGG - Intronic
974286547 4:59876430-59876452 GGATGTTCACAATTTCAGGATGG + Intergenic
977583084 4:98746196-98746218 GCATGGACAGAATTTCACATGGG + Intergenic
982194739 4:152899596-152899618 GGATGAACACACTTTCAAGTTGG - Intronic
986179100 5:5376700-5376722 AGATGGACACAAAACCAGCTGGG + Intergenic
988441513 5:31239207-31239229 GGCTGGACACAATATCCTCTAGG - Intronic
992744977 5:79810593-79810615 GGAGAGACATCATTTCAGCTGGG + Intergenic
994155474 5:96498787-96498809 GGATTAACACAATTTCAGAGGGG - Intergenic
997318154 5:132955106-132955128 GGTTGGAGAGGATTTCAGCTAGG - Intronic
998549439 5:143063280-143063302 GGAAAGACACAATGGCAGCTTGG - Intronic
999104424 5:149058035-149058057 GGTTGGACTCAATGTCAGGTGGG - Intronic
999626175 5:153522619-153522641 GGATGGTCCCTCTTTCAGCTTGG - Intronic
1004080807 6:12390883-12390905 GGATTGACAGAAATTCAACTTGG + Intergenic
1005265912 6:24112215-24112237 GGATGTGAACAATTTCAGGTAGG - Intergenic
1010655272 6:78504379-78504401 CAATGGACACACTTTCAGTTTGG + Intergenic
1011706862 6:90009529-90009551 GGATGTACATCAATTCAGCTGGG - Intronic
1014066985 6:117138566-117138588 GGATGGAAAGAATATCAGCTAGG + Intergenic
1015174979 6:130296609-130296631 GCATGGACTCACTTTCAGCGAGG - Intronic
1016024257 6:139269756-139269778 GGATGCACACAGTATCATCTTGG + Intronic
1020223749 7:6263081-6263103 AGATGGACATACTGTCAGCTTGG - Intronic
1024097329 7:45993182-45993204 GGATGGATATAATTTCATTTGGG + Intergenic
1030055262 7:105578754-105578776 GAGTGGACACAATTTTAACTTGG - Intronic
1030983382 7:116211414-116211436 GCAGGGAGACATTTTCAGCTTGG + Intronic
1031919425 7:127589963-127589985 GGATTGACACAATTACAAATGGG + Intronic
1036018522 8:4815275-4815297 GGAAGGACACAAATGCAGATTGG - Intronic
1038702594 8:29862989-29863011 GGGTGGACCCAAATTCAGTTTGG - Intergenic
1039630433 8:39106500-39106522 GGATGCACGCAATTTCAACAGGG - Intergenic
1040093976 8:43425462-43425484 GGCTGGATACAATTTAAGATAGG + Intergenic
1040399764 8:47037672-47037694 GGCTGGATACAATTTAAGATAGG - Intergenic
1041859147 8:62491682-62491704 TGATGGAAATAATTCCAGCTTGG + Intronic
1041963370 8:63646480-63646502 GCATTGTCACATTTTCAGCTGGG + Intergenic
1041993751 8:64027824-64027846 GGATGGACACAATTTGGGATAGG - Intergenic
1043321166 8:78988632-78988654 GGATGAAAACATTTTCAGTTTGG + Intergenic
1044427142 8:92064990-92065012 AGATGCACACACATTCAGCTAGG - Intronic
1055123613 9:72692388-72692410 AGATGAACACAAAATCAGCTAGG - Intronic
1057590510 9:96369127-96369149 AGATGGACACAAATGCAGCAAGG + Intronic
1057710233 9:97434376-97434398 GGACGTACACAATTTCAGTTAGG + Intronic
1060677090 9:125525049-125525071 ACATGGACTCAATTTGAGCTGGG + Intronic
1188364300 X:29295737-29295759 TGATGGACAGAGTTTCATCTTGG - Intronic
1192229975 X:69257837-69257859 AGAAGGCCACAATTTCTGCTTGG + Intergenic
1194874589 X:99171205-99171227 TGATGGTCACAGGTTCAGCTTGG - Intergenic
1195648591 X:107261154-107261176 GGATGAACACTACTTCAGCCAGG + Intergenic
1196558806 X:117122345-117122367 AGATGGACACTATTTCTACTTGG - Intergenic
1199263042 X:145797687-145797709 GTATGGCAACAACTTCAGCTGGG - Intergenic
1199710712 X:150467214-150467236 GAAGAGACACAATTTCAGTTTGG + Intronic
1200862894 Y:8011855-8011877 TGATGGTCACAATCTCACCTCGG + Intergenic