ID: 1072328116

View in Genome Browser
Species Human (GRCh38)
Location 10:94318609-94318631
Sequence GTGTGGGTGATCCACAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328116_1072328121 -7 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data
1072328116_1072328126 8 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328126 10:94318640-94318662 TTGGGAGGAGCAGGAGGCAGTGG No data
1072328116_1072328124 2 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328124 10:94318634-94318656 AGCACCTTGGGAGGAGCAGGAGG No data
1072328116_1072328129 20 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328129 10:94318652-94318674 GGAGGCAGTGGGTAGGCTAGAGG No data
1072328116_1072328130 21 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328130 10:94318653-94318675 GAGGCAGTGGGTAGGCTAGAGGG No data
1072328116_1072328128 13 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data
1072328116_1072328127 9 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328127 10:94318641-94318663 TGGGAGGAGCAGGAGGCAGTGGG No data
1072328116_1072328119 -10 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328119 10:94318622-94318644 TCACCCACACTCAGCACCTTGGG No data
1072328116_1072328131 29 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328131 10:94318661-94318683 GGGTAGGCTAGAGGGAAGACAGG No data
1072328116_1072328123 -1 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328123 10:94318631-94318653 CTCAGCACCTTGGGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328116 Original CRISPR GTGTGGGTGATCCACAAGGA TGG (reversed) Intronic
900510588 1:3058399-3058421 GTGTGGCTGCTGCAGAAGGACGG - Intergenic
902874851 1:19334867-19334889 GTGTGGGTCATGCACAGGGGAGG + Intergenic
903582284 1:24380616-24380638 AAGTGGGTGAGCCAAAAGGAAGG + Intronic
905892191 1:41524510-41524532 GTGTGTGTGTTCCAGGAGGATGG + Intronic
907514148 1:54982525-54982547 CTGTGGGGGATCCACATGGAAGG + Intronic
907724002 1:57001699-57001721 GTGAGGGTGAACCCCAAGTAGGG - Intronic
913970696 1:143413526-143413548 GTCTGTGTGATCCTCATGGAAGG - Intergenic
914065073 1:144239137-144239159 GTCTGTGTGATCCTCATGGAAGG - Intergenic
914114078 1:144727217-144727239 GTCTGTGTGATCCTCATGGAAGG + Intergenic
915901182 1:159847641-159847663 GAGTGGGAGGTCCACAGGGAGGG - Intronic
918201571 1:182272185-182272207 TTGTGGGTGAGGCACAAGGCAGG + Intergenic
918595972 1:186293509-186293531 CAGTGTGTGATCAACAAGGAAGG + Intergenic
922283703 1:224149876-224149898 GTGAGGGAGATACACAGGGATGG + Intronic
923317251 1:232793020-232793042 GTGAGGGTGATCTATCAGGATGG + Intergenic
1067033962 10:42899356-42899378 GTGTGTGTGCTGCAGAAGGAAGG - Intergenic
1067056951 10:43058063-43058085 GTGTGGGGGATGGAGAAGGAGGG - Intergenic
1068627459 10:59264590-59264612 ATGTGTGTGAGCCACAAGCAAGG - Intronic
1069390038 10:67925740-67925762 GAGTGAGTGATCCAGAAGAAGGG - Intronic
1072328116 10:94318609-94318631 GTGTGGGTGATCCACAAGGATGG - Intronic
1073175547 10:101554499-101554521 GTGTGGGAGAAGCAGAAGGAAGG - Exonic
1077087658 11:762726-762748 CTGGGGTTGATCCCCAAGGACGG - Intronic
1083680598 11:64350002-64350024 GTGTGCGGGCTCCACACGGAGGG + Intronic
1084496934 11:69510650-69510672 GTGGGTGTGATCTACAGGGAGGG - Intergenic
1091770376 12:3147475-3147497 GTGGGGGCGATCCTGAAGGAGGG - Intronic
1091880185 12:3970878-3970900 TTGTGGGGGATCCACAAAGCCGG - Intergenic
1094798218 12:34000778-34000800 GTGTGGCTGATACTCAAGCAGGG + Intergenic
1096539219 12:52295396-52295418 GTGTGTCTGATCCCAAAGGAAGG + Intronic
1099186948 12:79525313-79525335 GTGTGGGAGATCCACTTTGAAGG - Intergenic
1100384367 12:94091854-94091876 GTGTGGGTGATTCAGAAGTCTGG - Intergenic
1101776080 12:107795170-107795192 GTGTGGGTTTTCCACAAAGGAGG + Intergenic
1102362819 12:112303065-112303087 TTGTGGGTGATTCACCAGGGAGG + Intronic
1104514867 12:129415767-129415789 GTGTGGATGGTCCTTAAGGATGG - Intronic
1104745283 12:131206795-131206817 GGGTGGGGGCTCCACAGGGAGGG - Intergenic
1104789054 12:131470311-131470333 GGGTGGGGGCTCCACAGGGAGGG + Intergenic
1107930052 13:45299628-45299650 GTTGGGGTGATTCCCAAGGAAGG + Intergenic
1110048505 13:70861477-70861499 GTCTGGGTAATTTACAAGGAAGG + Intergenic
1111828868 13:93301535-93301557 GTGTTGGTGAGCCATGAGGAAGG + Intronic
1112874303 13:104016341-104016363 ATGTGGGGGATACACCAGGAGGG - Intergenic
1124594704 15:31082973-31082995 GTGGGGGCGACCCACAAGGAGGG + Intronic
1126782844 15:52153187-52153209 GAGCGAGTGATCCACAAGAAGGG - Intronic
1127492296 15:59476537-59476559 GGGTGTGGGATCCACAAGGTGGG + Intronic
1130981012 15:88811852-88811874 GTGGGGGTGATGCCCATGGATGG - Intronic
1134613422 16:15629604-15629626 GTGTGGGTGATCCAGGAGAGTGG - Intronic
1134691240 16:16192152-16192174 GTGAGGGTGATCCAGGTGGAGGG + Intronic
1135619710 16:23945269-23945291 GTGTGGGTGAGCCAAGGGGAAGG + Intronic
1137013808 16:35352441-35352463 GGGTGGGTGATCCTGAAGCAGGG - Intergenic
1138827400 16:60337003-60337025 GTATGGGGTACCCACAAGGAGGG - Intergenic
1140343258 16:74186485-74186507 GTCTGGGTGACCCTTAAGGAAGG + Intergenic
1145015035 17:19391046-19391068 GTGTGGGGACTCTACAAGGAGGG - Intergenic
1145999381 17:29122177-29122199 GTGTGGCTGGTCCATAGGGACGG - Exonic
1150213618 17:63454974-63454996 ATGTGGGGGACCCACAGGGAGGG - Intergenic
1153718799 18:7880372-7880394 TTGTTGGGAATCCACAAGGAAGG + Intronic
1158548855 18:58417837-58417859 GGGTGGTTGATGCATAAGGAAGG + Intergenic
925887355 2:8404280-8404302 CTGTAGGTGATACACAAAGAGGG - Intergenic
932835592 2:75032967-75032989 GTCTGGGAAATCCAAAAGGATGG - Intergenic
934175392 2:89574452-89574474 GTCTGTGTGATCCTCATGGAAGG - Intergenic
934285708 2:91648815-91648837 GTCTGTGTGATCCTCATGGAAGG - Intergenic
935932213 2:108139503-108139525 GTGTTGGTGCTACATAAGGAAGG - Intergenic
937292407 2:120789542-120789564 TTGTGGGAGCTCCACAAGGGCGG - Intronic
939160459 2:138582759-138582781 GTGTGGGTGACCCACCCTGAGGG - Intergenic
944513247 2:200485074-200485096 GGGAGGGTGATTCAGAAGGAAGG - Intergenic
944662960 2:201936476-201936498 CTTTGGGGGATCCATAAGGAAGG - Intergenic
947500562 2:230668074-230668096 GAGTTGGTGACCCAGAAGGAGGG + Intergenic
948141948 2:235680155-235680177 GCGTGGGTAGCCCACAAGGAAGG - Intronic
948586875 2:239025430-239025452 GGGTGGCTGAGCCACAAGGTTGG - Intergenic
1170742670 20:19071790-19071812 CAGTGGGTGATGCACAAAGATGG - Intergenic
1172399785 20:34640017-34640039 GTGGGTGAGATCCACAAAGAAGG + Intronic
1176271748 20:64239030-64239052 GTGTGGGTGACACACGAGGCAGG - Intronic
1178618562 21:34154495-34154517 GTGAGGGTCATCTGCAAGGAAGG - Intergenic
1178625186 21:34210435-34210457 GTCTCAGTGATCCACAGGGAAGG - Intergenic
1180563788 22:16645850-16645872 GTGTGGGTGTCCCCAAAGGAGGG - Intergenic
1183458030 22:37933256-37933278 GTCTGGGTCACCCCCAAGGATGG + Intronic
1183767749 22:39894621-39894643 GTGTGTGTGATGGACAATGATGG + Intergenic
1183989525 22:41588883-41588905 GGGTGGGTTACCCACAGGGAGGG + Intronic
949109977 3:248031-248053 GAGTGGGTGAACAACAAGAAAGG - Intronic
949881571 3:8664991-8665013 GTGAGGGTGATTCTTAAGGAAGG - Intronic
950025911 3:9819802-9819824 GTGTGTGTCATGCACAAGGAAGG + Intronic
955083641 3:55680800-55680822 GTGTGGATGATCCAACAGGGAGG + Intronic
955318698 3:57959247-57959269 GTGTGGTTGATTCACCAGGGTGG + Intergenic
962740501 3:138359840-138359862 GTGTGTGTGCTCAAGAAGGATGG + Intronic
964490715 3:157233062-157233084 GAGTGGGTGATGCTGAAGGAAGG + Intergenic
965538701 3:169851164-169851186 GTGGGCATGATCCACCAGGAGGG + Intronic
967021372 3:185526017-185526039 GGTTGGGTGATACTCAAGGATGG - Intronic
967105881 3:186254757-186254779 GTGTGGGTGACACACTAGGAGGG - Intronic
969219709 4:5751833-5751855 GTGAGGGTGTTCCAGGAGGAAGG + Intronic
969461776 4:7332824-7332846 GTGTGGGTGAGGCAGGAGGAGGG + Intronic
979364413 4:119803298-119803320 GTGTGGAAGATTCACAAGTAGGG + Intergenic
980291928 4:130855365-130855387 ATTTGGGTCATCCAGAAGGATGG - Intergenic
980501963 4:133668129-133668151 GTGCAGGTGTTCCACAAAGAAGG + Intergenic
983644312 4:169974206-169974228 GTGAGGGTGGTTCACAAGGAAGG - Intergenic
983857954 4:172668759-172668781 AAGTGGGCCATCCACAAGGAAGG - Intronic
985856837 5:2434971-2434993 GTGTGGGTGCTGCAGAAGGCTGG + Intergenic
989171875 5:38479317-38479339 GTGTAGGGGATCCAAAAGTAGGG + Exonic
992841240 5:80697139-80697161 CTGTGGGTGATAAACAAGAAAGG - Intronic
997663076 5:135604202-135604224 CTGTGCCTCATCCACAAGGATGG - Intergenic
997979610 5:138460575-138460597 GTGTGGCTGATATACTAGGAAGG - Intergenic
998015325 5:138726932-138726954 GGCTGGCTGATCCTCAAGGAAGG + Intronic
999327317 5:150651149-150651171 ATGTGGGTGTGCCACAGGGAGGG + Exonic
1002162120 5:177320547-177320569 GTCTGGGTGCTCCACCAGCACGG - Intergenic
1003660858 6:8060300-8060322 TTGTGGCTGAAACACAAGGAGGG + Intronic
1003960157 6:11201376-11201398 GGGTGGGTGACCCACAGGGCTGG - Intronic
1004585762 6:16998435-16998457 GAGTGAGTGATCATCAAGGAAGG - Intergenic
1007412791 6:41674652-41674674 GTGGGGGTGTTACCCAAGGAGGG - Intergenic
1008723407 6:54386534-54386556 GTGTGAGGGAGCCACATGGAAGG - Intronic
1018624186 6:165761438-165761460 TTGTGGGTGACCCGCATGGAGGG - Intronic
1020657265 7:10942361-10942383 GTGTGGTTGATCCATAACTAAGG + Intergenic
1021941080 7:25679527-25679549 ATGTTGCTGATCCACATGGAGGG + Intergenic
1030656496 7:112173933-112173955 GGGCAGGTGACCCACAAGGAGGG + Intronic
1033757068 7:144404059-144404081 GTGTGGGTGAGCCCCACGGCTGG - Intronic
1034306575 7:150048752-150048774 GCGTGGGAGAGCCACCAGGAGGG + Intergenic
1034604602 7:152300508-152300530 GTCTGTGTGATCCTCATGGAAGG + Intronic
1034800271 7:154051891-154051913 GCGTGGGAGAGCCACCAGGAGGG - Intronic
1034967478 7:155400172-155400194 GTGAGGGTGATGCCCCAGGATGG - Intergenic
1035708383 8:1694998-1695020 GTCTGGGTGAGCCCAAAGGACGG + Intronic
1037875297 8:22543303-22543325 CTGTGGGCCTTCCACAAGGAAGG - Intergenic
1038700778 8:29847538-29847560 GTGTGGCTGGTCCCCAAGGTGGG + Intergenic
1050825472 9:9940084-9940106 ATGTGGGGAAACCACAAGGAAGG + Intronic
1055888027 9:81088293-81088315 GTGTGTGTGATACACAAAGTAGG + Intergenic
1061848811 9:133402855-133402877 CTGTGGGTGAGCCAGAATGAGGG - Intronic
1062550334 9:137083134-137083156 GTGTGGTGGATCCACAAGGCGGG - Exonic
1186837751 X:13454731-13454753 GTGTGGGTGAGCTTAAAGGAAGG + Intergenic
1193425651 X:81337964-81337986 GGGTGGGGGACCCACATGGAAGG + Intergenic
1194397269 X:93401812-93401834 GTGTGGAAGAGCCACAGGGATGG + Intergenic
1195493476 X:105501821-105501843 GTGTGGGGGATCCAGCAGAATGG - Intronic
1196144704 X:112304103-112304125 CTGTGGCTGATACCCAAGGAAGG + Intergenic
1197155938 X:123270272-123270294 GTGTGTATCATCCACTAGGAGGG + Intronic
1198437167 X:136628529-136628551 GTGTGGATGGTCCTCAAGTAGGG + Intergenic
1202600232 Y:26586803-26586825 GTGTGGGTGTCCCCAAAGGAGGG - Intergenic