ID: 1072328117

View in Genome Browser
Species Human (GRCh38)
Location 10:94318613-94318635
Sequence CTGAGTGTGGGTGATCCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 145}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328117_1072328129 16 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328129 10:94318652-94318674 GGAGGCAGTGGGTAGGCTAGAGG No data
1072328117_1072328124 -2 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328124 10:94318634-94318656 AGCACCTTGGGAGGAGCAGGAGG No data
1072328117_1072328131 25 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328131 10:94318661-94318683 GGGTAGGCTAGAGGGAAGACAGG No data
1072328117_1072328128 9 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data
1072328117_1072328132 29 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328132 10:94318665-94318687 AGGCTAGAGGGAAGACAGGCTGG No data
1072328117_1072328123 -5 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328123 10:94318631-94318653 CTCAGCACCTTGGGAGGAGCAGG No data
1072328117_1072328126 4 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328126 10:94318640-94318662 TTGGGAGGAGCAGGAGGCAGTGG No data
1072328117_1072328130 17 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328130 10:94318653-94318675 GAGGCAGTGGGTAGGCTAGAGGG No data
1072328117_1072328127 5 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328127 10:94318641-94318663 TGGGAGGAGCAGGAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328117 Original CRISPR CTGAGTGTGGGTGATCCACA AGG (reversed) Intronic
901735404 1:11309213-11309235 CTGAGTGTGGATCATCCAACTGG + Intergenic
902407950 1:16196565-16196587 GTGAGTCAGGGTGATCCAGAGGG - Intergenic
902874848 1:19334863-19334885 CCCAGTGTGGGTCATGCACAGGG + Intergenic
904857755 1:33511919-33511941 GTGAGTGTGTATAATCCACAGGG + Intergenic
904877852 1:33670385-33670407 GTGAGTTTGGATGAACCACAGGG - Intronic
906204626 1:43980112-43980134 CTGAGTGTGGGTGACCAGCTGGG + Intronic
906649695 1:47503839-47503861 CTTAGTGTTGGTGTTCCCCAGGG - Intergenic
908961471 1:69701389-69701411 CTCAGTGTGTGTGATACACATGG - Intronic
913150296 1:116035221-116035243 CTGAGTGCGGGTGATCTAGGTGG + Exonic
913345251 1:117802794-117802816 CTGAGTGTGGGTGGAAGACAAGG - Intergenic
914856936 1:151359437-151359459 CTGAGTTTAAGTGATCCACCCGG + Intergenic
915726376 1:158020648-158020670 TTGAGTGTGGATTATCCACTTGG + Intronic
916118347 1:161506860-161506882 CTGAGTGTGGGAGAAGCAGAAGG + Intronic
920894407 1:210030769-210030791 CTGTGTGTGGCTGTTGCACAGGG + Intronic
921341338 1:214137440-214137462 CTGAGTGAGGGGGATACAAAAGG - Intergenic
1063080856 10:2765904-2765926 CTGAGAGAGGGTGAGCAACAGGG + Intergenic
1063536670 10:6890763-6890785 CAGAGTGCGGGTGCTCCAGAGGG - Intergenic
1065126325 10:22577598-22577620 CTGAGGCTGGGTGATTCATAAGG - Intronic
1066650434 10:37650225-37650247 TTGAGTGTGGGTGGTTTACAAGG + Intergenic
1067291305 10:44945214-44945236 ATGAGAGAGTGTGATCCACAGGG - Intergenic
1071163575 10:82779389-82779411 CTGAGTTTCTGTGATCCACAGGG + Intronic
1071532953 10:86402768-86402790 CTGAGGCGGGGTGATCCAAAGGG + Intergenic
1072313622 10:94180889-94180911 CTGAGCCTGGGAGCTCCACAAGG - Intronic
1072328117 10:94318613-94318635 CTGAGTGTGGGTGATCCACAAGG - Intronic
1075317119 10:121461639-121461661 GTAGGTCTGGGTGATCCACAGGG - Intergenic
1075481322 10:122784409-122784431 GTGTGTTTGGGAGATCCACATGG + Intergenic
1075576986 10:123584680-123584702 GTGAGTGTGGCTGATTCTCATGG + Intergenic
1076030148 10:127150379-127150401 CTGAGAGTTGCTGATACACAGGG - Intronic
1076688858 10:132210613-132210635 CAGAGTGTGGGAGATGCAGAAGG + Intronic
1080233127 11:30040279-30040301 CTAAATGTGGGTAATCCCCAAGG + Intergenic
1080429720 11:32186963-32186985 CTGAGTGTGTGTCATGCCCAGGG - Intergenic
1081618673 11:44605487-44605509 CTGAGTGTGGGGGATGGACAAGG + Intronic
1081619714 11:44612064-44612086 CAGTGGGTGGGTGATCCCCACGG - Intronic
1082147013 11:48683070-48683092 CTCAGTGTGAGTGATGCAGAGGG + Intergenic
1084230431 11:67748552-67748574 CTGAGTCTGATTGATCCTCATGG + Intergenic
1084889258 11:72228680-72228702 CTGAGTGTGGGAGGCCCAAACGG + Intronic
1091346665 11:134858945-134858967 CTGTGTGTGTGTGAGCCCCAAGG + Intergenic
1092609845 12:10160481-10160503 CTGAGTTTGTGGAATCCACATGG + Intronic
1097727769 12:63094273-63094295 CTGGGTGTGAGTGATCTTCAGGG + Intergenic
1097859087 12:64500218-64500240 GTGATAGTGGGTTATCCACATGG - Intronic
1101214424 12:102566404-102566426 CTGAGTGGGGGTGGATCACAAGG + Intergenic
1102437142 12:112933380-112933402 CTGAGGTTGGATGATCCATAAGG - Intergenic
1104745285 12:131206799-131206821 CAGAGGGTGGGGGCTCCACAGGG - Intergenic
1104789052 12:131470307-131470329 CAGAGGGTGGGGGCTCCACAGGG + Intergenic
1105828428 13:24143138-24143160 CTGGGTGAGGGTGCTCCCCAGGG + Intronic
1106295891 13:28413257-28413279 CTGAGTGTGAATGGACCACAGGG - Intronic
1106746151 13:32710291-32710313 ATGAGTGTGGGGGATAAACATGG + Intronic
1107586216 13:41850780-41850802 CTGATTGTTAGTGATCCTCATGG - Intronic
1110048504 13:70861473-70861495 CTGAGTCTGGGTAATTTACAAGG + Intergenic
1113437212 13:110302491-110302513 CTCAGTGTGGGTGAGCTGCAGGG - Intronic
1114025463 14:18521974-18521996 CTGAGTGTTTGTTCTCCACATGG + Intergenic
1114143221 14:19941604-19941626 CTGAGTCTCCATGATCCACAGGG - Intergenic
1114927375 14:27421219-27421241 CTGAGACTGGGTGATTTACAAGG + Intergenic
1117241294 14:53836727-53836749 CTAAGTGTGGGTGACCGACCAGG - Intergenic
1117676030 14:58155710-58155732 CTGGGTGTGGCTCATCCACCTGG - Intronic
1117736626 14:58774677-58774699 CTGAGTGTCTGGGATGCACAGGG + Intergenic
1119252450 14:73168481-73168503 CTGAGTGTTGGTGATACAAGTGG + Intronic
1120588476 14:86346137-86346159 CTGAGTCTGTATGTTCCACAGGG + Intergenic
1123401485 15:19991110-19991132 CTGAGTGTCGGTAACCCACAGGG - Intergenic
1128561251 15:68669324-68669346 CTGGGTGTGTGAAATCCACACGG + Intronic
1130624001 15:85494523-85494545 CTGAGTGTGGGACATTCACTTGG - Intronic
1133893323 16:9902398-9902420 CTGAGGGTGGCAGAGCCACAGGG + Intronic
1135619709 16:23945265-23945287 GTGAGTGTGGGTGAGCCAAGGGG + Intronic
1138103208 16:54271004-54271026 CTGAGAGTTGCTGATCCAAAGGG - Intergenic
1140257352 16:73348769-73348791 GTGAGGGTTGGTCATCCACAAGG - Intergenic
1142230606 16:88898476-88898498 CTGAGAGTGGGTGATCCCTAAGG + Intronic
1144087290 17:11822248-11822270 CTGGGACTGCGTGATCCACAAGG - Intronic
1144236117 17:13262311-13262333 CTGTGTTTGGGTGACCCTCAAGG + Intergenic
1144434960 17:15231902-15231924 TTGAGCGTGGCTGCTCCACAGGG - Intronic
1146077350 17:29743575-29743597 CTGACTATGGGAGAGCCACAGGG + Intronic
1147555598 17:41477037-41477059 CTGAGAGCGGGTGACCCAGATGG - Exonic
1149586699 17:57793418-57793440 CTGAGTTTGGGTGATTCTCATGG - Intergenic
1150579595 17:66460251-66460273 CTGTGTGTGTATGATCCATATGG + Intronic
1151440435 17:74125414-74125436 CAGAGTGTGGGTCACCCAGAGGG + Intergenic
1152235880 17:79138220-79138242 CTGAGTGTGCGTGTTGCACACGG - Intronic
1154461250 18:14590105-14590127 CTGAGTCTCCGTGATCCACATGG - Intergenic
1155877506 18:31104646-31104668 CAGAGGATGAGTGATCCACAGGG + Intergenic
1160694383 19:475488-475510 GTGGGTGTGGGTGAGCCCCACGG + Intergenic
1162188645 19:8927327-8927349 CTGAGTCTGGGTGGTCAGCAGGG + Intronic
1163085703 19:14978387-14978409 CTGAGTGTGTGTGATGTACTTGG - Intronic
1163521963 19:17796730-17796752 CTGGGTGTGGGAGAACCAAAAGG + Intronic
1166326227 19:42052760-42052782 CAGGGAGGGGGTGATCCACAGGG - Intronic
1166337760 19:42118750-42118772 CTGAGGGTGTGTGATCCATCAGG - Intronic
1167390768 19:49193555-49193577 CTCAGTGGGGGGGCTCCACAGGG - Intronic
925999285 2:9317250-9317272 ATGAGTGTGTGTGATGCACGGGG - Intronic
936596065 2:113849274-113849296 CTGAGTAATGGTGATTCACAAGG - Intergenic
937672432 2:124552435-124552457 CTGAGCGTGGGCAATCCACCTGG - Intronic
937786110 2:125900386-125900408 CTGAGTCGGGTGGATCCACAAGG - Intergenic
942637397 2:178022403-178022425 TTGCCTGTGGGTCATCCACATGG + Intronic
946596800 2:221314831-221314853 CAGAGTTTTGGTGATTCACAAGG - Intergenic
948586876 2:239025434-239025456 CTGGGGGTGGCTGAGCCACAAGG - Intergenic
1170456270 20:16536796-16536818 CTGAGTAGGGTTGGTCCACAGGG - Intronic
1173135366 20:40434283-40434305 CTGACTGTGTCTGAGCCACATGG - Intergenic
1176181692 20:63752485-63752507 CTGGGTGTGGCTGGGCCACATGG - Intronic
1176813257 21:13567743-13567765 CTGAGTCTCCGTGATCCACATGG + Intergenic
1178099364 21:29250905-29250927 CTGACTATGGGTGTTTCACAAGG - Intronic
1178429229 21:32504484-32504506 CTGAGTCTGATTGATCCTCATGG - Intronic
1178625187 21:34210439-34210461 CAGAGTCTCAGTGATCCACAGGG - Intergenic
1180449638 22:15449504-15449526 CTGAGTGTTTGTTCTCCACATGG + Intergenic
1182548884 22:31090638-31090660 CGGAGTGTGGGAGATCCAGGAGG + Intronic
1184336917 22:43859307-43859329 CTGGGCGTGGGTGAGCCACCTGG - Intronic
952836032 3:37602979-37603001 TTGGGGGTGAGTGATCCACAGGG - Intronic
953943241 3:47121077-47121099 CTGAATTTGGGTGACCCAGAGGG + Exonic
954266838 3:49476359-49476381 CTGAGCTCAGGTGATCCACACGG - Intronic
955004902 3:54959289-54959311 TTGAGTTTGGGAGCTCCACAGGG + Intronic
955456053 3:59122902-59122924 CTGAGGCTGGGTAATCTACAAGG + Intergenic
955940253 3:64140459-64140481 CAGAATGTGGCTGATCCTCAAGG + Intronic
957046994 3:75383572-75383594 CTGAGTTTGATTGATCCTCATGG + Intergenic
961513778 3:127420382-127420404 CCGAGTGTGGGTGCTCCTCTTGG - Intergenic
961879070 3:130047650-130047672 CTGAGTTTGATTGATCCTCATGG + Intergenic
968977532 4:3829866-3829888 ATGTGTGTGGGTGACCCAAAGGG + Intergenic
969824058 4:9742834-9742856 CTGAGTCTGATTGATCCTCATGG - Intergenic
975651471 4:76597811-76597833 CTGAGTGTGGGAGAACCAAAAGG + Intronic
975904095 4:79188900-79188922 CTCACTGTTGGTGATCCCCAGGG - Intergenic
976933574 4:90599667-90599689 CTGAGTTTCTGTGCTCCACAGGG + Intronic
977888585 4:102280266-102280288 CACAGTGTAGGTGAACCACAGGG - Intronic
981664545 4:147208231-147208253 CTAAATGTGGGTGTTCCCCAAGG + Intergenic
981781025 4:148429019-148429041 CTGAGTGTGGTTGAGCCGCGTGG - Intronic
984022679 4:174505035-174505057 CTGAGTGTGGTTAACCCACATGG - Intronic
986977287 5:13409401-13409423 CTGAGTTTCTGTGCTCCACAGGG - Intergenic
992572814 5:78077247-78077269 CTTAGGGTTTGTGATCCACAAGG + Intronic
994777218 5:104049867-104049889 CTGAGTGTGGGTACCCCAAAAGG + Intergenic
996747652 5:126858786-126858808 CTGAGGGTGGGAGATCCTCTGGG - Intergenic
997130905 5:131275242-131275264 CTGAGTGTTGGTGATTTACATGG + Intronic
998443532 5:142181247-142181269 GTGAGTGTGGGTGACCCAAAGGG + Intergenic
999086687 5:148898328-148898350 CTGAGGGTCCGGGATCCACAGGG - Intergenic
1001124674 5:169008587-169008609 GTGAGTCTGGATGAGCCACACGG + Intronic
1001232191 5:169998089-169998111 GTGAGTGGGGGTGATCCTCAGGG - Intronic
1002640441 5:180628208-180628230 CTGACTGTGGGTGAGCCATGTGG + Intronic
1005426845 6:25711821-25711843 CTGTGTATGAGTGGTCCACAAGG + Intergenic
1009917791 6:70017647-70017669 CTAAGTGTTGCTGCTCCACAGGG - Intronic
1010366639 6:75059099-75059121 TTGAGCCTTGGTGATCCACATGG - Intergenic
1015176311 6:130312977-130312999 CTGAGAGCTGGTGATCCTCAGGG - Intronic
1016314045 6:142767048-142767070 CTGTGTTTTGGTGATCCAAAAGG - Intronic
1019216000 6:170444301-170444323 CTGACTGAGGGTGTTTCACAGGG - Intergenic
1019810997 7:3165065-3165087 CTGACTGTGGGGGACCCACAAGG + Intronic
1020314128 7:6892581-6892603 CTGAGTCTGATTGATCCTCATGG + Intergenic
1022850536 7:34257110-34257132 CTGAATGTGGATGCACCACATGG - Intergenic
1023264028 7:38386876-38386898 CTGAGTGAGGATAATCCTCAGGG - Intronic
1023602183 7:41890984-41891006 CTGAGTGTGTCTGACCCACAGGG - Intergenic
1024042289 7:45564947-45564969 CTAGTTGTGGGTGATCCACCTGG + Intergenic
1026521083 7:71118766-71118788 CTGAGGGTAGGAGATACACAGGG - Intergenic
1026818520 7:73530866-73530888 CTGAGTCTGGGTAATGTACAAGG + Intergenic
1029854788 7:103504618-103504640 CAGAGTGTGGCAGAACCACAAGG + Intronic
1030075864 7:105736050-105736072 CTGAAGATGGGTGATCCAAAGGG + Intronic
1030834163 7:114262818-114262840 ATGAGTGTGCATGATCAACAAGG - Intronic
1031430683 7:121664821-121664843 CTGAGTGTGTTTGTTCCACTAGG + Intergenic
1032104648 7:129016704-129016726 GTTAGTGAGAGTGATCCACAAGG + Intronic
1035028195 7:155840707-155840729 CTGAGTGTGTTTGTTCCACGCGG + Intergenic
1035358998 7:158297438-158297460 CTGAGGGTTGCTGAACCACAAGG - Intronic
1038271211 8:26077748-26077770 CTGAGTGTGGGTCATTGGCATGG + Intergenic
1040365202 8:46708623-46708645 CAGAGTCAGGGTGAACCACAGGG - Intergenic
1041375616 8:57207515-57207537 CTCAGGGTGGGCCATCCACATGG + Intergenic
1041376379 8:57211894-57211916 CTCAGGGTGGGCCATCCACATGG + Intergenic
1041403428 8:57469209-57469231 CAGAGTCTGAGTGATTCACATGG + Intergenic
1044791145 8:95848513-95848535 CTGAGGGTGGGTGATAGCCAAGG - Intergenic
1047559096 8:125966929-125966951 GTGAGGGTGGTTGTTCCACAGGG - Intergenic
1048130374 8:131689483-131689505 CTGAGACTGGGTAATTCACAAGG - Intergenic
1053173008 9:35904456-35904478 CTGAGTCTGGGTGATTCCAAGGG + Intergenic
1062001568 9:134218505-134218527 CTGGGTGTGGCTGACCCACTTGG + Intergenic
1062182523 9:135198267-135198289 CTGGGTGTGGGTGCACCGCACGG + Intergenic
1194784552 X:98065678-98065700 TTGAGTGTGGCTGATCCCCCTGG - Intergenic