ID: 1072328120

View in Genome Browser
Species Human (GRCh38)
Location 10:94318625-94318647
Sequence CCTCCCAAGGTGCTGAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 884
Summary {0: 1, 1: 0, 2: 11, 3: 115, 4: 757}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328120_1072328132 17 Left 1072328120 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG 0: 1
1: 0
2: 11
3: 115
4: 757
Right 1072328132 10:94318665-94318687 AGGCTAGAGGGAAGACAGGCTGG No data
1072328120_1072328131 13 Left 1072328120 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG 0: 1
1: 0
2: 11
3: 115
4: 757
Right 1072328131 10:94318661-94318683 GGGTAGGCTAGAGGGAAGACAGG No data
1072328120_1072328126 -8 Left 1072328120 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG 0: 1
1: 0
2: 11
3: 115
4: 757
Right 1072328126 10:94318640-94318662 TTGGGAGGAGCAGGAGGCAGTGG No data
1072328120_1072328129 4 Left 1072328120 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG 0: 1
1: 0
2: 11
3: 115
4: 757
Right 1072328129 10:94318652-94318674 GGAGGCAGTGGGTAGGCTAGAGG No data
1072328120_1072328127 -7 Left 1072328120 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG 0: 1
1: 0
2: 11
3: 115
4: 757
Right 1072328127 10:94318641-94318663 TGGGAGGAGCAGGAGGCAGTGGG No data
1072328120_1072328130 5 Left 1072328120 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG 0: 1
1: 0
2: 11
3: 115
4: 757
Right 1072328130 10:94318653-94318675 GAGGCAGTGGGTAGGCTAGAGGG No data
1072328120_1072328128 -3 Left 1072328120 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG 0: 1
1: 0
2: 11
3: 115
4: 757
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328120 Original CRISPR CCTCCCAAGGTGCTGAGTGT GGG (reversed) Intronic
900629408 1:3625561-3625583 CCTCGCAAGGTGCTGCGCGGCGG - Intronic
900656060 1:3758009-3758031 CCTCCCAAAGTGCTGTGATTAGG + Intronic
901179426 1:7330981-7331003 CCTCCCAAAGTGCTGATTACAGG - Intronic
901195959 1:7439842-7439864 CTGTCCAAGGTGCGGAGTGTCGG + Intronic
901318909 1:8327548-8327570 CCTCCCGAAGTGTTGAGAGTAGG - Intronic
901389444 1:8934348-8934370 CCTCCCAAAGTGCTGGGTACAGG + Intergenic
901516139 1:9747785-9747807 CCTCCCAAAGTGCTGATTGCAGG - Intronic
901726470 1:11246769-11246791 CCTCTCTACTTGCTGAGTGTAGG - Intronic
901929860 1:12590202-12590224 CCTCTGGAGGTGCTGAGGGTGGG + Intronic
902142850 1:14370939-14370961 CCTCCCAAAGTGCTGAGATTAGG + Intergenic
902296644 1:15472167-15472189 CCTCCCAAAGTGCTAAGTGCTGG - Intronic
902367730 1:15988538-15988560 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
902589541 1:17463781-17463803 CCTCCCAAAGTGCTGGGATTGGG - Intergenic
902745889 1:18474068-18474090 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
903841541 1:26245283-26245305 CCTCCCAAAGTGCTGAGTGCTGG + Intronic
904025684 1:27502093-27502115 CCTCCCAAAGTGCTGAGATTTGG - Intergenic
904349780 1:29897647-29897669 CCTCCCCAGGTGCTGATGGTTGG + Intergenic
904628238 1:31821122-31821144 CCTCCCAAAGTGTTGGGAGTGGG - Intergenic
904651101 1:32006548-32006570 CCTCCCAAAGTGCTGGGATTGGG + Intergenic
905178522 1:36152906-36152928 CCTCCCAAAGTGCTGGGATTAGG + Intronic
905854608 1:41300341-41300363 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
906500471 1:46338419-46338441 CCTCCCAAAGTGCTGTGATTAGG - Intergenic
907016672 1:51022320-51022342 CCTCCCAAAGTGCTGGGTTACGG + Intergenic
907134769 1:52129823-52129845 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
907179379 1:52555886-52555908 CCTCCCAAAGTGCTGGGACTAGG - Intergenic
907860401 1:58347362-58347384 CTTCCCAAAGTGCTGATTGCAGG + Intronic
908221954 1:62015923-62015945 CCTCCCAAAGTGCTGACTATAGG + Intronic
908742250 1:67341159-67341181 CCTCCCCAGGTGCTGGGATTAGG - Intronic
908988856 1:70060059-70060081 CCTCCCAAAGTGCTAAGTGCTGG - Intronic
909156757 1:72087850-72087872 CCTCCCAAAGTGCTGAGATTAGG + Intronic
910191680 1:84601789-84601811 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
910196921 1:84651469-84651491 CCTCCCAAAGTGCTGGGATTAGG - Intronic
912621567 1:111164877-111164899 CCTCCCAAAGTGCTGGGATTAGG + Intronic
912940112 1:114037303-114037325 CGTCGCAAGGTGCTCAGTGGGGG - Intergenic
913008984 1:114664194-114664216 CCTCCCAACGTGCTGATTATAGG + Intronic
913252629 1:116924601-116924623 CTTCCCAAGGTGCTGAGAACTGG + Intronic
913940430 1:125098750-125098772 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
913955010 1:143281634-143281656 CCTCCCAAAGTGCTGGGTTTAGG - Intergenic
913982430 1:143533807-143533829 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
914051158 1:144133495-144133517 CCTCCCAAAGTGCTGGGTATGGG + Intergenic
914128023 1:144831947-144831969 CCTCCCAAAGTGCTGGGTATGGG - Intergenic
914231808 1:145768570-145768592 CCTCCCAAAGTGCTGATTACAGG + Intronic
914664700 1:149823334-149823356 CCTCCCATGTTCATGAGTGTAGG - Intergenic
914671065 1:149870484-149870506 CCTCCCATGTTCATGAGTGTAGG + Intronic
914796404 1:150923976-150923998 CCTCCCAAAGTGCTGGGATTGGG - Intergenic
915293783 1:154905502-154905524 CCTCCCAAAGTGCTTAATTTTGG + Intergenic
915417182 1:155751287-155751309 CCTCCCAAAGTGCTGGGAATAGG - Intronic
915702003 1:157805115-157805137 CATCCCAAGGTACTGAGTACAGG + Intronic
915716948 1:157953712-157953734 CCTCCCAAAGTGCTGATTACAGG - Intergenic
916896706 1:169171138-169171160 CCTCCCAAAGTGCCGATTATAGG - Intronic
917092866 1:171371610-171371632 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
917272090 1:173288194-173288216 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
917534930 1:175867654-175867676 CTTCCCACAGTGCTGAGTGTGGG + Intergenic
918334546 1:183495612-183495634 CCTCCCAAAGTGCTGGGATTAGG - Intronic
918677367 1:187304081-187304103 CCTCCCAAAGTGCTGATTAGAGG + Intergenic
919369328 1:196704349-196704371 CCTCCCAAAGTGCTGGGAGCTGG + Intronic
919672056 1:200347015-200347037 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
920774973 1:208927254-208927276 CCTCCCAAAGTGCTGATTACAGG - Intergenic
922041319 1:221901427-221901449 CCTCCCAAAGTGCTGGGATTGGG - Intergenic
922145443 1:222939570-222939592 CCTCCCAAAGTGCTGGGATTAGG - Intronic
922417911 1:225438665-225438687 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
922426610 1:225502464-225502486 CCTCCCAAATTGCTGGGTGTAGG + Intronic
922771050 1:228183098-228183120 CCTCCCAAAGTGCTGTGATTAGG - Intergenic
922882365 1:228990513-228990535 CCTGCCAGGGTGCGGTGTGTGGG - Intergenic
922946711 1:229522460-229522482 TCTCCCAAAGTGCTGAGATTGGG + Intronic
923620355 1:235574112-235574134 CCTCTCAAAGTGCTGAGATTAGG - Intronic
1063659474 10:8024316-8024338 CCTCCCAAAGTGCTGGGGGGAGG - Intergenic
1063667945 10:8076529-8076551 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1064008329 10:11715322-11715344 CCTCCCAAAGTGCTGATTGCGGG - Intergenic
1064197010 10:13252062-13252084 CCTCCCAAAGTGCTGGGTTACGG + Intergenic
1064420839 10:15189443-15189465 CCTCCCAAAGTGCTGGGCGAGGG + Intergenic
1064518960 10:16181120-16181142 CCTCCCAAAGTGCTGGGTACAGG - Intergenic
1064534416 10:16343989-16344011 CCTCCCAAAGTGCTGGGATTTGG + Intergenic
1064993388 10:21275912-21275934 CCTCCCAAAGTGCTGGGATTGGG + Intergenic
1065379888 10:25079276-25079298 CCCCCCACGGTGCACAGTGTGGG + Intergenic
1065741890 10:28804483-28804505 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1065858204 10:29847804-29847826 CCTCCCCAGGTGCTGACTACAGG + Intergenic
1065887236 10:30089238-30089260 CTTCCCTAGGTGGTGAGGGTGGG + Intronic
1066643480 10:37580446-37580468 CCTCCCAAAGTGCTGATTGCAGG - Intergenic
1066760769 10:38749803-38749825 CCTCCCAAAGTGCAGGGTATGGG - Intergenic
1066779711 10:38931084-38931106 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1067853806 10:49772951-49772973 GGTCACAAGGTGCTCAGTGTGGG + Intergenic
1068624263 10:59223779-59223801 CCTCCCAAGTAGCTGAGACTAGG + Intronic
1068693192 10:59939101-59939123 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1068985694 10:63105724-63105746 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1069176956 10:65302779-65302801 CCTCCCAATGTGCTGATTACAGG - Intergenic
1069369891 10:67736709-67736731 CCTCCCAAAGTGCTGGGATTTGG + Intergenic
1070111178 10:73488035-73488057 CCTCCCAAAGTGCTGGGGTTAGG + Intronic
1070239831 10:74668478-74668500 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1070566572 10:77607869-77607891 CCTCTCGAGTGGCTGAGTGTGGG - Intronic
1070938600 10:80322263-80322285 CCACCCAAGGTGTTGAGTTTAGG - Intergenic
1071118725 10:82253239-82253261 GCTCCCAGGGAGCTAAGTGTTGG - Intronic
1072037965 10:91581689-91581711 CCTCCCAAAGTGCTGCTTGAAGG + Intergenic
1072328120 10:94318625-94318647 CCTCCCAAGGTGCTGAGTGTGGG - Intronic
1072357235 10:94623821-94623843 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1072565273 10:96611722-96611744 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1073001922 10:100292233-100292255 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1073078726 10:100842680-100842702 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1074527863 10:114277438-114277460 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1074604111 10:114943273-114943295 CCTCCCAAAGTGCTGATTACAGG - Intronic
1074609493 10:115007654-115007676 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1074644765 10:115435273-115435295 CCTCCCAAAGTGCTGGGATTGGG + Intronic
1074650602 10:115520178-115520200 CCAGCCAAGTTGGTGAGTGTTGG - Intronic
1074672745 10:115812731-115812753 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1075061910 10:119262596-119262618 CCTCCCAAAGTGCTGGGATTTGG + Intronic
1075415273 10:122258158-122258180 CCTCCCCAGGGGCTGCATGTAGG + Intergenic
1075527002 10:123195324-123195346 CCTCCCCAGGTGTTGGGGGTTGG - Intergenic
1075657003 10:124168725-124168747 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1076121248 10:127938409-127938431 CCTCCCAAGGTGCTGGGACAGGG - Intronic
1077679457 11:4225062-4225084 GCTCACAAGGTGCTCAGTGGGGG + Intergenic
1077688875 11:4321646-4321668 GCTCACAAGGTGCTCAGTGGGGG + Intergenic
1079102247 11:17548973-17548995 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1079200553 11:18373944-18373966 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1081178126 11:39954042-39954064 CCTCCTAAAGTGCTGATTATAGG - Intergenic
1081952856 11:47060492-47060514 CCTCCCAAAGTGCTGATTACAGG + Intronic
1082187262 11:49198867-49198889 CCTCCCAAGTAGCTGAGATTAGG + Intronic
1082840882 11:57688983-57689005 CCTCCCAGAGTGCTGAGTGCTGG + Intronic
1082930267 11:58595831-58595853 CCTCCCAAAGTGCTGGGTATAGG + Intronic
1083400573 11:62420566-62420588 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1083425586 11:62583351-62583373 CCTCCCAAAGTGTTGAGATTAGG - Intronic
1083462505 11:62823801-62823823 CCTCCCAAAGTGCTGCCTATGGG + Intronic
1083555610 11:63623829-63623851 CCTCCCAAAGTGCTGATTACAGG + Intergenic
1083815279 11:65129210-65129232 CCTTCCAAAGTGCTGATTATAGG + Intronic
1083947670 11:65933655-65933677 CCTCCCAAAGTGCTGAGGTTAGG - Intergenic
1084732311 11:71081545-71081567 CCTGCCAAAGTGCAGAGGGTGGG + Intronic
1084886647 11:72213808-72213830 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1085209702 11:74764953-74764975 CCTCCCAAAGTGCTAAGATTAGG - Intronic
1085240986 11:75055381-75055403 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1086315146 11:85583441-85583463 CCTCTCAAAGTGCTGAGATTAGG + Intronic
1086679076 11:89646556-89646578 CCTCCCAAGTAGCTGAGATTAGG - Intergenic
1086970358 11:93074579-93074601 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1087754214 11:102037980-102038002 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1088268223 11:108008011-108008033 CCTCCCAAAGTGCCGATTATAGG + Intergenic
1088628991 11:111755844-111755866 CCTCCCAAAGTGCTGGGTGCTGG + Intronic
1088642364 11:111885219-111885241 CCTCCCAAAGTGCTGGGATTAGG - Exonic
1089640706 11:119845495-119845517 CCTCCCTAGGTCCTGACTGATGG - Intergenic
1090020246 11:123121998-123122020 CCTCCCAAAGTGCTGGGATTGGG + Intronic
1090300579 11:125634249-125634271 CCTCCCAAAGTGCTGTTTTTTGG + Intronic
1090513031 11:127395651-127395673 CCTCCCAAAGTGCTGATTCCAGG + Intergenic
1090787006 11:130058360-130058382 CCTCCCAAGGAATTGAGGGTGGG - Intergenic
1090987822 11:131787638-131787660 CCTCCCAAAGTGCTGGGATTGGG + Intronic
1091254619 11:134172779-134172801 CCTCCCAAAGTGCTGGGATTGGG - Intronic
1092208324 12:6630377-6630399 CTTCCCAAAGTGCTGGGTGCTGG + Intronic
1092222762 12:6726345-6726367 CCTCCCAAAGTGCTGAGAACAGG - Intronic
1092391902 12:8087643-8087665 CCTCCCAAAGTGCTGGTTATAGG + Intronic
1093144135 12:15544246-15544268 CCTCCCAAAGTGCTGGGAGCTGG - Intronic
1093459671 12:19396769-19396791 CCTCCCATGGTGCTGAGAACAGG + Intergenic
1094003595 12:25723466-25723488 CATCCCAAGAAGCTGAGTGGAGG - Intergenic
1094192648 12:27712725-27712747 CCTGCCAAGGGGCTGAGTGTGGG + Intronic
1094262413 12:28516344-28516366 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1094616092 12:32037652-32037674 CCTCCCAAAGTGCTGATTATAGG + Intergenic
1094720556 12:33058816-33058838 CCTCCCAAAGTGCTGGGATTCGG + Intergenic
1095676781 12:44928993-44929015 CATCCCAAGGAGATGAGTTTGGG - Intergenic
1096682744 12:53267791-53267813 CCTCCCAAAGTGCTGACTACGGG - Intergenic
1096703634 12:53404273-53404295 CCTCCCAAAGTGCTGATTACAGG - Intronic
1097064945 12:56314157-56314179 CCTCCCAAAGTGCTGGGTTTTGG + Intronic
1097874883 12:64633875-64633897 CCTCCCAAAGTGCTGACTATAGG - Intronic
1097883285 12:64705265-64705287 TCTCCCAAGTAGCTGAGAGTTGG - Intergenic
1098117636 12:67197082-67197104 CCTCCCAAAGTGCTGGGTCTAGG + Intergenic
1098270323 12:68763643-68763665 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1099729688 12:86484616-86484638 CCTCTCAGTGTTCTGAGTGTGGG - Intronic
1100089884 12:90955520-90955542 CCTCCAAAGGTGTAGAATGTGGG - Intergenic
1100546966 12:95612682-95612704 CCTCCCAAAGTGCTGGGATTGGG + Intergenic
1100615177 12:96225874-96225896 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1100634882 12:96426113-96426135 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1100894347 12:99162801-99162823 CCTCCCAGAGTGCTGAGATTAGG - Intronic
1101366622 12:104077498-104077520 CCTCCCAAACTGCTGAGATTGGG + Intronic
1101414580 12:104498174-104498196 CCTCCCAAAGTGCTGTGAGCTGG + Intronic
1101465876 12:104948957-104948979 CCTCCCAAAGTGCTGATTACAGG - Intronic
1101620731 12:106385078-106385100 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1101765366 12:107693426-107693448 CCTCCCAAAGTGCTGGGTGCTGG + Intronic
1102159894 12:110760061-110760083 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1102532486 12:113557022-113557044 CCTCCCAAAGTGCTGGGATTGGG + Intergenic
1102759796 12:115375332-115375354 CCTCCCTTGGTGGTGAGAGTTGG - Intergenic
1102895789 12:116597373-116597395 CCTCCCAAAGTGCTGGGTGCTGG - Intergenic
1102929325 12:116850418-116850440 CCTCGCAAAGTGCTGAGTGCTGG + Exonic
1103077022 12:117992029-117992051 CCTCCCAAAGTGCTCATTTTAGG - Intergenic
1103105541 12:118221481-118221503 CCTCCCAAAGTGCAAAGTGCTGG + Intronic
1103349218 12:120271711-120271733 CCTCCCAAAGTGCTGATTGCAGG - Intergenic
1103352579 12:120295085-120295107 CCTCCCAAAGTGCTGAGCCACGG + Intergenic
1103519031 12:121525498-121525520 CCTCCCAAAGTGCTAAGTGCTGG + Intronic
1104369278 12:128208698-128208720 GCTTCCAGGGTTCTGAGTGTGGG - Intergenic
1105233794 13:18526502-18526524 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1105372169 13:19811825-19811847 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1105962457 13:25354554-25354576 CCTCCCAAAGTGCAAAGTGCTGG - Intergenic
1106192430 13:27465439-27465461 CCTCCCAAAGTGCTGTGGGCTGG - Intergenic
1106204869 13:27583512-27583534 CCTCCCAAAGTGCTGATTACAGG + Intronic
1106483128 13:30151458-30151480 TGTCCCATGGTGCTGAGGGTGGG - Intergenic
1106664427 13:31836732-31836754 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1106727145 13:32497624-32497646 CCTCCCAAAGAGCAGAGTGCTGG + Intronic
1106917618 13:34531903-34531925 CCTCCCAAAGTGCTGGGTGCTGG - Intergenic
1107909100 13:45088641-45088663 CCTCCCAAGTAGCTGAGATTGGG + Intergenic
1109022345 13:57114438-57114460 CCTCCCAAAGTGCAAAGTGCTGG - Intergenic
1110432110 13:75436397-75436419 CCTCCCAAAGTGCTGGGATTTGG - Intronic
1110505297 13:76279053-76279075 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1111300319 13:86341275-86341297 CCTCCCAAAGTGCTGAGGTAAGG + Intergenic
1111630129 13:90839774-90839796 GGTCACAAGGTGCTCAGTGTGGG - Intergenic
1111630890 13:90844921-90844943 GGTCACAAGGTGCTCAGTGTGGG - Intergenic
1111631244 13:90848773-90848795 GGTCCCAAGGTGCTCAGTGGGGG + Intergenic
1112247395 13:97747400-97747422 CCTCCCAAAGTGCTGGGTTAAGG + Intergenic
1112315332 13:98356889-98356911 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1112333982 13:98498988-98499010 CCTCCCAAAGTGCTGATTATAGG - Intronic
1112474598 13:99719406-99719428 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1113002898 13:105663278-105663300 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1113459536 13:110472369-110472391 CCTCCCAAAGTGCTGGGATTGGG + Intronic
1113793515 13:113043200-113043222 CCTGCCAAGGGGCTGTGTGTTGG - Intronic
1113812330 13:113150229-113150251 GCTCCTCAGGTGCTGAGTGGTGG + Intergenic
1113828024 13:113271863-113271885 CCTCCCAAAGTGCTGATTATAGG + Intergenic
1116894087 14:50298568-50298590 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1117131036 14:52687167-52687189 CCTCCCAAAGTGCTGATTACAGG - Intronic
1117395425 14:55304754-55304776 CCTCCCAAAGTGTTGATTATAGG + Intronic
1117689088 14:58286810-58286832 CCTCCCAAAGTGCTGTGCCTGGG + Intronic
1118005399 14:61560803-61560825 CCTCCCAAAGTGCTGAGATTAGG - Intronic
1118179618 14:63479278-63479300 TCTCCCATGGTGCTGTGGGTGGG + Intronic
1118196604 14:63632372-63632394 CCTCCCAAGGTGCTGGGATAAGG - Intronic
1118411894 14:65488076-65488098 CCTCCCAAAGTGCTGAGATTAGG + Intronic
1119153486 14:72387291-72387313 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1119487484 14:75000361-75000383 CCTCCCAAAGTGCTGGGATTCGG + Intergenic
1119840347 14:77788125-77788147 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1120163567 14:81170444-81170466 CCTCCCAGTGTTCTGAGTGGAGG - Intergenic
1120696079 14:87647241-87647263 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1121105849 14:91279154-91279176 CCTCCCAAAGTGCTGATTATAGG + Intronic
1121321846 14:92996123-92996145 CCTCCCAAGGAGCTGGGACTAGG - Intronic
1121447139 14:93986323-93986345 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1121756555 14:96407835-96407857 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1122461313 14:101897896-101897918 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1202931502 14_KI270725v1_random:40106-40128 CCTCCCAAAGTGCTGGATATGGG - Intergenic
1123395674 15:19932730-19932752 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1123444833 15:20320695-20320717 CCTCCCAAAGTGCTAGGTATGGG - Intergenic
1124271692 15:28287978-28288000 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1124922029 15:34036851-34036873 CCTCCCAAGGTGCTGGGATATGG - Intronic
1125528482 15:40395040-40395062 CCTCCCAAAGTGCTGAGGCCAGG + Intergenic
1125671060 15:41473100-41473122 CCTCCTAAAGTGCTTGGTGTTGG + Intronic
1125711916 15:41793971-41793993 CCTCCCAAAGTGCTGATTACAGG - Intronic
1125960431 15:43825545-43825567 CCTCCCACAGTGCTGAGTGTTGG + Intergenic
1126457905 15:48884609-48884631 CCTCCCCAGGTGCTGGGAGTGGG + Intronic
1126657940 15:51000395-51000417 CCTCCCAAGGTGCTGGGATTAGG + Intronic
1126804669 15:52335259-52335281 CCTCCCAAAGTGCTGGGTATAGG - Intronic
1127266365 15:57365538-57365560 GTTCCCCAGGTACTGAGTGTAGG + Intergenic
1127272356 15:57413113-57413135 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1127305756 15:57704540-57704562 ACTCCCCATGTGCTGATTGTAGG - Intronic
1127473662 15:59312618-59312640 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1128120433 15:65142148-65142170 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1128169150 15:65495345-65495367 CCTCCCAAAGTGCTGAGAACAGG - Intronic
1128827819 15:70736695-70736717 CCTCCCAAAGTGCTGGGTACAGG + Intronic
1128892542 15:71343968-71343990 CCTCCCAAAGTGATGGGGGTGGG + Intronic
1129300944 15:74625118-74625140 ACTCCCCTGGTTCTGAGTGTGGG - Intronic
1129305657 15:74659612-74659634 CCTCCCAAAGTGCTGAGATTTGG - Intronic
1129378330 15:75149168-75149190 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1129456106 15:75676917-75676939 TCTCCCCAGGAGCTGAGTCTGGG + Exonic
1130200314 15:81819924-81819946 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1130225534 15:82055438-82055460 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1130300873 15:82679378-82679400 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1130540573 15:84818119-84818141 CCTCCCCAGGACCTGAGTGGGGG + Intronic
1131205544 15:90442710-90442732 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1132463978 16:69160-69182 CCTCCAAAGGTGTCGAGTTTGGG + Intronic
1132597332 16:759268-759290 CCTCCCACGGTGCTGGCTGAAGG + Intronic
1132607656 16:800264-800286 GCGCCCACGGGGCTGAGTGTAGG - Intronic
1132782238 16:1633811-1633833 CCTCCCAAAGTGCTGATTACAGG - Intronic
1132856207 16:2046014-2046036 CCTCCCAAGGTGCTGTCTGCAGG + Intronic
1133311523 16:4849851-4849873 CCTCCCAAAGTGCTGGGTCCGGG + Intronic
1133681676 16:8125751-8125773 CCTCCCAAAGTGCTGAGATTAGG + Intergenic
1133742655 16:8663082-8663104 CCTCCCAAGTAGCTGATTATAGG - Intergenic
1134623722 16:15709195-15709217 CCTCCCAAGGTGCTGGGATTTGG + Intronic
1134826795 16:17291259-17291281 CCTCTCAAACTGCTGGGTGTGGG + Intronic
1134853843 16:17503599-17503621 CCTCCCAAAGTGCTAAGATTAGG + Intergenic
1134895453 16:17882341-17882363 CCTCCCAAAGTGCTGGGTACAGG + Intergenic
1135047404 16:19167259-19167281 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1135160034 16:20086005-20086027 CCTGCCAAGGCTCTGAGAGTGGG + Intergenic
1135178595 16:20253343-20253365 CCTCCCAAAGTGCTGATTACAGG + Intergenic
1136010057 16:27357718-27357740 TCTCCCAAGGTGCTGGGTACAGG + Intronic
1136342415 16:29653560-29653582 CCTCCCAAGGCGCTGGGCGCTGG + Intergenic
1136427219 16:30176981-30177003 CCTCCCAAAGTGCTAATTGCAGG - Intergenic
1136476550 16:30517193-30517215 CCTCCCAAAGTGCTGGGATTTGG - Intronic
1136503640 16:30688360-30688382 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1136682682 16:31977149-31977171 CCTCCCCAGGTCCTGAGGCTGGG - Intergenic
1136698127 16:32104911-32104933 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1136721992 16:32328229-32328251 CCTCCCAAAGTGCTGGGTATGGG + Intergenic
1136769478 16:32822952-32822974 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1136782942 16:32918317-32918339 CCTCCCCAGGTCCTGAGGCTGGG - Intergenic
1136798625 16:33048196-33048218 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1136840316 16:33534192-33534214 CCTCCCAAAGTGCTGGGTATGGG + Intergenic
1136886852 16:33935533-33935555 CCTCCCCAGGTCCTGAGGCTGGG + Intergenic
1136901005 16:34038007-34038029 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1136935698 16:34461888-34461910 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1136939746 16:34511735-34511757 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1136948856 16:34690618-34690640 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1136956339 16:34791088-34791110 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1136960074 16:34836829-34836851 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1136964120 16:34886682-34886704 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1136968264 16:34941265-34941287 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1137093267 16:36221139-36221161 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1137219879 16:46438099-46438121 CCTCCCAAAGTGCTGAGATTAGG - Intergenic
1137660436 16:50201056-50201078 CCTCCCAAAGTGCTGATTATAGG + Intronic
1137667156 16:50257999-50258021 CCTCCCAAGGTGCTGGGATTAGG + Intronic
1138570718 16:57870371-57870393 CCTCCCAAAGTGCTGAGTGCTGG - Intergenic
1138674238 16:58639428-58639450 CCTCCCAAAGTGCTGGGTGCTGG - Intergenic
1139246717 16:65452001-65452023 TCTCCCAAAGTGCTGATTATAGG - Intergenic
1139450936 16:67027886-67027908 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1139535100 16:67567096-67567118 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1139757487 16:69156411-69156433 CCTCCCAAAGTGCTGGGTGCTGG + Intronic
1140088643 16:71818929-71818951 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1141379260 16:83560908-83560930 CCGCCCCAGGGGCTGAGGGTTGG + Intronic
1141955736 16:87370272-87370294 CATCCCAGTGTGCTGAGTGCGGG - Intronic
1141969614 16:87472190-87472212 CCTCCCGAGGGTCTGACTGTAGG - Intronic
1142199447 16:88754128-88754150 CTTCCCAAGGAGCTGGATGTGGG - Intronic
1142330053 16:89446345-89446367 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1203004439 16_KI270728v1_random:189545-189567 CCTCCCAAAGTGCTGGGTATGGG - Intergenic
1203071895 16_KI270728v1_random:1085057-1085079 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1203085591 16_KI270728v1_random:1182301-1182323 CCTCCCCAGGTCCTGAGGCTGGG - Intergenic
1203136049 16_KI270728v1_random:1725976-1725998 CCTCCCAAAGTGCTGGGTATGGG - Intergenic
1203150482 16_KI270728v1_random:1834485-1834507 CCTCCCAAAGTGCTGGGTATGGG + Intergenic
1142570668 17:871659-871681 CCTCCCAAAGTGCTGGGTACAGG + Intronic
1142882714 17:2894170-2894192 CCTCCCAAAGTGCTGGGTGCTGG - Intronic
1142955984 17:3522561-3522583 CCTCCCAAAGTGCTGGGGGGTGG - Intronic
1143204732 17:5133791-5133813 CTTCCCGAAGTGCTGACTGTGGG + Intronic
1143237642 17:5417091-5417113 CCTCCTAAAGTGCTGATTATAGG + Intronic
1143243170 17:5461361-5461383 CCTCCCAAAGTGCTGGGGCTGGG - Intronic
1143381458 17:6498842-6498864 CCTGCCATGGTGCTGGCTGTAGG - Intronic
1143556622 17:7665883-7665905 CCTCCCAATGTGCTGTGTGCTGG + Intronic
1143662493 17:8334780-8334802 CCTCCCAAAGTGCTGATTACAGG + Intergenic
1143668322 17:8378072-8378094 CCTCCCAAAGTGCTGGGATTGGG - Intronic
1144265104 17:13561506-13561528 CCTCCCAAGGAGCTGGGATTTGG + Intronic
1144875785 17:18396470-18396492 CTTCCCAAAGCGCTGACTGTGGG + Intergenic
1144969974 17:19102253-19102275 CCTCCCAAAGTGCTGGGATTGGG + Intergenic
1144977942 17:19149811-19149833 CCTCCCAAAGTGCTGGGATTGGG - Intronic
1144990279 17:19228421-19228443 CCTCCCAAAGTGCTGGGATTGGG + Intronic
1145156443 17:20547951-20547973 CTTCCCAAAGCGCTGACTGTGGG - Intergenic
1145292329 17:21558347-21558369 CCTCCCAAGGTGCTGGTGCTGGG - Intronic
1145387628 17:22427559-22427581 CCTCCCAAGGTGCTGGTGCTGGG + Intergenic
1146160456 17:30556777-30556799 CTTCCCGAAGTGCTGACTGTGGG + Intergenic
1146296808 17:31656464-31656486 CCTCCCAAAGTGCTGATTACAGG + Intergenic
1146428097 17:32762928-32762950 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1146843939 17:36172038-36172060 CTTCCCGAAGTGCTGACTGTGGG - Intronic
1146856245 17:36259973-36259995 CTTCCCGAAGTGCTGACTGTGGG - Intronic
1146864374 17:36328402-36328424 CTTCCCGAAGTGCTGACTGTGGG + Intronic
1146872152 17:36383884-36383906 CTTCCCGAAGTGCTGACTGTGGG - Intronic
1146879514 17:36434969-36434991 CTTCCCGAAGTGCTGACTGTGGG - Intronic
1146883441 17:36456112-36456134 CTTCCCAAAGTGCTGACTGTGGG - Intergenic
1147057488 17:37845562-37845584 CCTCCCAAAGTGCTGAGTGCTGG - Intergenic
1147057646 17:37846558-37846580 CCTCCTAAAGTGCTGAGTGCTGG + Intergenic
1147067233 17:37928990-37929012 CTTCCCGAAGTGCTGACTGTGGG + Intronic
1147075038 17:37984508-37984530 CTTCCCGAAGTGCTGACTGTGGG - Intronic
1147078765 17:38008551-38008573 CTTCCCGAAGTGCTGACTGTGGG + Intronic
1147086563 17:38064054-38064076 CTTCCCGAAGTGCTGACTGTGGG - Intronic
1147094703 17:38132486-38132508 CTTCCCGAAGTGCTGACTGTGGG + Intergenic
1147102506 17:38188017-38188039 CTTCCCGAAGTGCTGACTGTGGG - Intergenic
1147143205 17:38470491-38470513 CCTCCCCAGGTCCTGAGGCTGGG - Intronic
1147467697 17:40623706-40623728 CCTCCCAAAGTGCTGAGACTTGG + Intergenic
1148653359 17:49265604-49265626 CCTCCCAAAGTGCTGGGATTTGG + Intergenic
1148823881 17:50378012-50378034 CCTCCCAAAGTGCTGGGATTGGG + Intronic
1148874494 17:50678662-50678684 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1148978850 17:51553480-51553502 CCTCCCAAAGTGCTGAAATTAGG + Intergenic
1149838397 17:59935729-59935751 CCTCCCAAAGTGCTAAGTGCTGG + Intronic
1149847079 17:60014483-60014505 CTTCCCGAAGTGCTGACTGTGGG - Intergenic
1149966737 17:61172375-61172397 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1150085438 17:62271100-62271122 CTTCCCGAAGTGCTGACTGTGGG - Intergenic
1151043287 17:70889448-70889470 CCTCCCAAAATGCTGAGATTAGG - Intergenic
1151298520 17:73204037-73204059 CCTCCCAAAGTTCTGGGTCTTGG - Intronic
1151525227 17:74661052-74661074 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1151665756 17:75544315-75544337 CCTCCCAATATGCTGAGGGCAGG + Intronic
1151776309 17:76205388-76205410 CCTCCCAAAGTGCTGGGAATAGG + Intronic
1151817368 17:76477877-76477899 CCTCCCAAGGCGCTGCCTGCAGG - Intronic
1151898437 17:76996130-76996152 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1151908110 17:77062613-77062635 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1152283759 17:79400581-79400603 CCTCACAAGGTGTTGGGGGTGGG + Intronic
1152877607 17:82795982-82796004 CCTACCAAGGTGGTGGGTGAGGG + Intronic
1153453038 18:5250804-5250826 CCTTCCAGGGTTCTGACTGTTGG + Intergenic
1153486451 18:5603624-5603646 CCTCCCAAAGTGCTGAGATTAGG - Intronic
1153688366 18:7567804-7567826 CCCCTCATGGTGCTGAGTGCGGG - Exonic
1153744615 18:8164906-8164928 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1154332605 18:13442232-13442254 GCTATCAAGGTGCTGAGAGTGGG + Intronic
1154400094 18:14028613-14028635 CCTGCCATGGGGCTGAGGGTGGG - Intergenic
1154519222 18:15208946-15208968 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1154945180 18:21156168-21156190 CCTCCCAAAGTGCTGGGATTCGG + Intergenic
1154945826 18:21160437-21160459 CCTCCCAAAGTGCTGGGATTCGG + Intergenic
1155079480 18:22393647-22393669 CCTCCCAAAGTGCTGGGTACAGG + Intergenic
1155215179 18:23636828-23636850 CCTCCCAAAGTGCTAGGTGTGGG + Intronic
1155225723 18:23727580-23727602 CCTCCCAAGGTGCTGGATTATGG + Intronic
1155281509 18:24245346-24245368 CCTCCCAAAGTGCTGAGACTAGG + Intronic
1155662886 18:28272923-28272945 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1156388409 18:36627270-36627292 CCACCGAAGATGCTGAGGGTAGG + Intronic
1156950073 18:42885327-42885349 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1157124534 18:44943698-44943720 CCTCAGCAGGAGCTGAGTGTGGG - Intronic
1157362382 18:47031733-47031755 CCTCCCAAAGTGCTGAGGTAGGG + Intronic
1157769324 18:50331799-50331821 CCTCCAAAAGGGCTGAGAGTAGG + Intergenic
1157953375 18:52065242-52065264 CCTCCCAAAGTGCTGGGTGCTGG - Intergenic
1158037642 18:53052884-53052906 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1158577042 18:58646542-58646564 CGTCACAAGGTGCTCAGTGGGGG + Intergenic
1158892012 18:61881168-61881190 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1159007562 18:63026020-63026042 CATCACAAAGTGCTGAGTTTAGG + Intergenic
1159444134 18:68519494-68519516 CCTCCCAAAGTGCTGAATTATGG - Intergenic
1159971743 18:74664241-74664263 CCTCCCGAAGTGCTGATTATAGG - Intronic
1161009943 19:1955173-1955195 CCTCGGAAGCTGCTGAGTCTTGG + Intronic
1161133233 19:2604211-2604233 CCTCCCAAAGTGCTGGGAGACGG - Intronic
1161147425 19:2687314-2687336 CCTCCCAAAGTGCTGGGGTTAGG + Intronic
1161194940 19:2981452-2981474 CCTCCCTAGGGGTTGAGGGTGGG + Intronic
1161606216 19:5216245-5216267 CTGCCGAAGGTGCTGGGTGTGGG + Intronic
1161814080 19:6488557-6488579 CCTCCCAAAATGCTGAGATTAGG - Intergenic
1161875444 19:6905084-6905106 CCTCCCAAAGTGCTGTTTATAGG - Intronic
1162434149 19:10646798-10646820 CCTCCCAAAGTGCTGATTGCAGG - Intergenic
1162570209 19:11467164-11467186 CTTCCCAAAGTGCTGAGATTAGG - Intronic
1162697964 19:12491611-12491633 CCTCCCAAAGTGCTGGTTGGTGG - Intronic
1162797837 19:13095746-13095768 CCTCCCAAGGAACTGAAAGTCGG - Exonic
1162899155 19:13784226-13784248 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1163042765 19:14614831-14614853 CCTCCCAACGTGCTGCGTGCTGG + Intergenic
1163281579 19:16321563-16321585 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1163679002 19:18669841-18669863 CATCCCAAGCTGCTGAGGGGAGG + Exonic
1163993018 19:21017108-21017130 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1163997864 19:21068954-21068976 CCTCCCAAAGTGCTGAGTAAAGG - Intergenic
1164295847 19:23909054-23909076 CCTCCCAAAGTGCTGGGACTAGG + Intergenic
1164314848 19:24078292-24078314 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1164315596 19:24085512-24085534 CCTCCCAAAGTGTTGGGTGTTGG - Intronic
1165499621 19:36177994-36178016 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1165508134 19:36247919-36247941 CCTCCCAAGTAGCTGGGTGTGGG - Intergenic
1166280514 19:41789489-41789511 CCTCCCAAAGTGCTGGGTACAGG - Intergenic
1166628385 19:44382552-44382574 CCTCCCAAAGTGCTGGGATTAGG + Exonic
1167537471 19:50063904-50063926 CCTCCCAAGTAGCTGGGTATGGG - Intergenic
1168034799 19:53710798-53710820 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1168093308 19:54100066-54100088 CCTCCCAAAGTGCTGGGCCTCGG + Intronic
1168269406 19:55241463-55241485 CCTCCCAAGGTCAGGGGTGTGGG - Exonic
1202671944 1_KI270709v1_random:63244-63266 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1202682288 1_KI270712v1_random:18006-18028 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1202690565 1_KI270712v1_random:86135-86157 CCTCCCAAAGTGCTGGGTATGGG + Intergenic
925810627 2:7696775-7696797 GGTCACAAGGTGCTCAGTGTGGG + Intergenic
925860582 2:8171897-8171919 CCTCCCCAGGTGCTTAGAGGGGG - Intergenic
926177733 2:10611523-10611545 CCTTCCAAAGTGCTGAGATTAGG - Intronic
926704840 2:15829677-15829699 CCTCCCAAAGTACTGAGTGCTGG - Intergenic
927250630 2:20992239-20992261 CCTCCCAGAGAGCTGAGGGTAGG + Intergenic
927507154 2:23622010-23622032 CATCCCAAGGGGATGAATGTGGG - Intronic
927778170 2:25918223-25918245 CCTCCCAAAGTGCTGGGTGCTGG + Intergenic
927900186 2:26813379-26813401 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
927979063 2:27361737-27361759 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
927999955 2:27515232-27515254 CCTCCCAAAGTGCTGATTACAGG + Intronic
928284194 2:29974692-29974714 ACTCTGAAGGTGGTGAGTGTTGG - Intergenic
928533995 2:32221414-32221436 CCTCCCAAAGTGCTGGGATTAGG + Exonic
929504423 2:42517313-42517335 CCTCCCAAAGTGCTGGGATTAGG - Intronic
929515041 2:42599336-42599358 CCTCCCAAAGTGCTGGGATTGGG - Intronic
929623449 2:43381425-43381447 TCTCCCAAGCCCCTGAGTGTGGG + Intronic
930066137 2:47329141-47329163 CCACCCCAGGAGCTGAGGGTAGG + Intergenic
930125622 2:47793986-47794008 CCTCCCAAAGTGCTGGGATTAGG + Intronic
930183248 2:48385670-48385692 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
931347921 2:61463575-61463597 CCTCCCAAAGTGTTGGGTTTAGG - Intronic
931398500 2:61909182-61909204 CCTCCCAAAGTGCTGATTACAGG + Intronic
932158917 2:69443210-69443232 GGTCACAAGGTGCTCAGTGTGGG + Intergenic
932236031 2:70121800-70121822 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
932236155 2:70122763-70122785 CCTCCCTAAGTGCTAAGTGTTGG + Intergenic
932596492 2:73096780-73096802 CCCCAAAAGGTGCTGAGTGAGGG - Intronic
933955848 2:87369869-87369891 CCTCCCAAAGTGCTGGGTATGGG - Intergenic
934240001 2:90261904-90261926 CCTCCCAAAGTGCTGGGTATGGG - Intergenic
934249489 2:90337075-90337097 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
934260089 2:91466383-91466405 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
934273190 2:91554850-91554872 CCTCCCAAAGTGCTGGGTATGGG + Intergenic
934303398 2:91798304-91798326 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
934324102 2:91994604-91994626 CCTCCCAAAGTGCTGGGTATGGG - Intergenic
934329863 2:92054453-92054475 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
934462454 2:94225170-94225192 CCTCCCAAAGTGCTGGGTATGGG - Intergenic
934468086 2:94284359-94284381 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
936094649 2:109522551-109522573 CCTCCCAAAGTGCTAGGTGCTGG + Intergenic
936251964 2:110874144-110874166 CCCCCCAGGCTGCTGAGGGTGGG - Intronic
936706975 2:115086710-115086732 CCTCCCAAAGTGCTGGGATTAGG + Intronic
937115322 2:119400770-119400792 CCTCCCAAAGTGCTGGGAGTAGG + Intergenic
937278294 2:120700468-120700490 CCTCCCAAGTAGCTGAGAGCTGG + Intergenic
937663598 2:124459490-124459512 CCTCCCAAAGTGCTGGGATTAGG - Intronic
937768411 2:125689163-125689185 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
938326751 2:130411500-130411522 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
938363193 2:130709959-130709981 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
938364760 2:130726255-130726277 CCTCCCAAAGTGCAAAGTGCTGG + Intergenic
938519219 2:132049581-132049603 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
938545210 2:132322645-132322667 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
938811041 2:134852904-134852926 CCTCCCAAAGTGCTGGGATTAGG - Intronic
939020780 2:136955906-136955928 CCTCCCAAAGTGCTGGGATTAGG + Intronic
939318005 2:140577678-140577700 CCTCCCAAAGTGCTGAGATATGG + Intronic
939402573 2:141713142-141713164 CCTCCCAAAGTGCTGGGATTAGG + Intronic
940017019 2:149117525-149117547 CCTCCCAAAGTGCTGGGTTAAGG + Intronic
940118523 2:150237064-150237086 CCTCCCAAAGTGCAAAGTGCTGG + Intergenic
940283153 2:152008026-152008048 CCTCCCAAAGTGCTGGGATTAGG + Intronic
941083640 2:161091278-161091300 CCTTCCCAGATGGTGAGTGTTGG + Intergenic
942104982 2:172624740-172624762 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
943062040 2:183049431-183049453 CGTCACAAGGTGCTCAGTGGGGG - Intergenic
943756164 2:191559630-191559652 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
944211225 2:197208542-197208564 CCTCCCAAAGTGCTGGGATTGGG - Intronic
944549328 2:200830933-200830955 CCTCCCAAAGTGCTGGGCATGGG - Intergenic
945356766 2:208849636-208849658 CCTCCCAAAGTGCTGAAGGGCGG - Intronic
945880555 2:215320836-215320858 CCTCCCAAAGTGCTGGGATTAGG + Intronic
946492942 2:220167666-220167688 CCTCTCAAAGTGCTGAGATTAGG + Intergenic
946734657 2:222742402-222742424 CCTCCCAAAGTGCTGGGTTACGG + Intergenic
947471323 2:230403863-230403885 CATCCCCAGCTGCTGAGTGGTGG + Intergenic
947811662 2:233008497-233008519 AGTCCCAAGGTGCTGACTTTTGG - Intronic
947913450 2:233817517-233817539 CCTCACATGTTACTGAGTGTTGG - Intronic
948334545 2:237197246-237197268 CCTCCCAAGGAGCTGGATGGGGG - Intergenic
948850683 2:240703935-240703957 CATCCCAGGGAGCTGAGGGTTGG - Intergenic
948957142 2:241302302-241302324 CCTCCCAAAGTGCAAAGTGCTGG - Intronic
1169129291 20:3156433-3156455 CCTCCCAAAGTACTGAGTACAGG + Intronic
1170169625 20:13395955-13395977 CCTCCCAAAGTGCTGATTACAGG + Intronic
1171476927 20:25417730-25417752 CCTCCCAAGTAGCTGAGATTAGG - Intronic
1171484671 20:25478204-25478226 CCTCCCAAAGTGCTGATTACAGG + Intronic
1171792472 20:29540361-29540383 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1172000648 20:31773546-31773568 CCTCTCAAAGTGCTGGGTATAGG + Intronic
1172370162 20:34383298-34383320 CCTCCCAAGGTATTGGGGGTGGG + Intronic
1172385112 20:34528712-34528734 CCTCCCAAAGTGCTGAGAACAGG - Intronic
1172396380 20:34609021-34609043 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1172557974 20:35859666-35859688 CCTCCCAAGTAGCTGAGACTAGG + Intronic
1172582206 20:36057324-36057346 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1172651290 20:36503742-36503764 CCTCCCAAAGTGCAAAGTGCTGG + Intronic
1173481705 20:43405900-43405922 CCTCCCAAGTAGCTGAGATTGGG - Intergenic
1173684786 20:44915539-44915561 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1174481071 20:50831833-50831855 CCTCCCAAGCTGCAGAGGGAGGG + Intronic
1174546226 20:51327282-51327304 ACTCCCAAAGTGCTGAGATTAGG + Intergenic
1174585598 20:51605654-51605676 CCTCCCAAAGTGCTGATTACAGG - Intronic
1175100607 20:56576168-56576190 CCTCTCAAAGTGCTGGGTGGTGG + Intergenic
1175953556 20:62596522-62596544 CCTCCCTTGGTGCTGAGAGCAGG + Intergenic
1176227409 20:64009157-64009179 CCTCCCAAGTAGCTGAGTACAGG - Intronic
1176593530 21:8668259-8668281 CCTTCCAAAGTGCTGGGTATGGG - Intergenic
1176777779 21:13154779-13154801 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1177696859 21:24584578-24584600 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1178378736 21:32090797-32090819 CCTCCCAAAGTGCTGATTATAGG + Intergenic
1178531699 21:33381625-33381647 CCTCCCAAACTGCTGGGTGCTGG + Intergenic
1178752335 21:35316860-35316882 GCTCCCATGGTGCTGAGCTTCGG + Intronic
1178754666 21:35337175-35337197 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1178799942 21:35784650-35784672 CCTCCCAAAGTGCTGATTACAGG - Intronic
1178877153 21:36422259-36422281 CGACCCAAGAGGCTGAGTGTTGG + Intergenic
1179513375 21:41889891-41889913 CCTCCCAAAGTGCTGGGAGCTGG + Intronic
1180276374 22:10645387-10645409 CCTTCCAAAGTGCTGGGTATGGG - Intergenic
1180525367 22:16254137-16254159 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1180550853 22:16538412-16538434 CCTCCCAAAGTGCTGGGTATGGG - Intergenic
1180592498 22:16953243-16953265 CCTCCCATTGTCCTGACTGTAGG + Intergenic
1180970663 22:19813425-19813447 CCTCCCACAGTGCTGAGTACAGG - Intronic
1181010384 22:20036919-20036941 CCACCCAAGCTGCTGTGTGCAGG + Exonic
1181299794 22:21871566-21871588 CCTCCCAAAGTGCTGAATTATGG - Intergenic
1181353144 22:22275499-22275521 CCTCCCAAAGTGCTGGGTATGGG + Intergenic
1181387534 22:22557234-22557256 CCTCTGAAGGTGCTGGGGGTTGG - Exonic
1181393365 22:22600023-22600045 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1182359235 22:29737071-29737093 CCTCCCAAAGTGCAACGTGTTGG - Intronic
1182369355 22:29800042-29800064 CCTCCCAAAGTGCTGGGACTAGG + Intronic
1182374398 22:29836036-29836058 CTTCCCAAAGTGCTGATTGCAGG - Intronic
1183231192 22:36583174-36583196 CCTCCCAAAGTGCTGCGAATAGG - Intronic
1183686093 22:39362256-39362278 CTCCCCAAGGTGCTGAGGCTGGG - Intronic
1183781659 22:40002878-40002900 CTTTGCAAGGTGCTGAGGGTTGG - Intronic
1183788201 22:40044329-40044351 CCCTCCGAAGTGCTGAGTGTGGG - Intergenic
1183863208 22:40684142-40684164 ACTCCCCAGGTGCTGGGTGGAGG - Intergenic
1183925198 22:41200845-41200867 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1184004958 22:41700856-41700878 CCTCCCAAAGTCCAAAGTGTTGG + Intronic
1184107289 22:42375514-42375536 CCTCCCAAAGTGCTGATTACAGG + Intergenic
1184289172 22:43489186-43489208 CCTCCCCACATGCTGTGTGTGGG - Intronic
1184705330 22:46208289-46208311 CCTCCCAAAGTGCTGGGATTGGG - Intronic
1184791408 22:46702545-46702567 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1185133240 22:49052426-49052448 CCTCCCGTGGTGCTGAGCGCAGG - Intergenic
1203237650 22_KI270732v1_random:21308-21330 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1203322997 22_KI270737v1_random:86772-86794 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
949160815 3:879712-879734 TCTCTCAAGGTCCTGACTGTGGG + Intergenic
949282223 3:2359793-2359815 CCTCCCAAAGTGCTGGGATTAGG + Intronic
949644382 3:6076410-6076432 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
949713338 3:6897953-6897975 CCTGCCAAGTTGCTGAGTGATGG - Intronic
950010077 3:9716726-9716748 CCTCCCAAAGTGCTGATTACAGG + Intronic
950610909 3:14125921-14125943 CCTACCAGGGCGCTGGGTGTGGG + Intronic
951170891 3:19540556-19540578 GCCCCAAAGATGCTGAGTGTTGG - Intergenic
951421738 3:22494216-22494238 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
952165518 3:30744452-30744474 CCTCCCAAAGTGCTGAGATTAGG - Intronic
952287986 3:31986487-31986509 CCTCCCAAAGTGCTGGGATTAGG - Intronic
952403061 3:32980832-32980854 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
953348704 3:42198203-42198225 CCTCCTACAGTGCTGAGTGATGG + Intronic
953957668 3:47244264-47244286 CCTCCCAGGGTGCTGTGTAGTGG - Intronic
954055317 3:48018547-48018569 CCTCCCAAAGTGCTGAGTGCTGG - Intronic
954169381 3:48788418-48788440 TCTCCCAAAGTGCTGGGTGCTGG + Intronic
954234716 3:49247530-49247552 CCTCCCAAAGTGCTGGGATTAGG - Intronic
954501683 3:51023670-51023692 CCTCCCAAAGTGCTGGGATTTGG + Intronic
954818086 3:53300120-53300142 CCTCCCAAAGTGCAAAGTGCTGG + Intronic
954989779 3:54830700-54830722 CCTCCCAAAGTGCTGGGATTTGG + Intronic
955095940 3:55798340-55798362 CCTCCGAAAGTGCTGGGTGCTGG - Intronic
955360706 3:58272058-58272080 CCTCCCAAAGTGCTGGGAATAGG + Intronic
956432132 3:69197866-69197888 CCTCCCAAAGTGCTGAGCCATGG - Intronic
956455238 3:69414569-69414591 CCTCCCAAAGTGCTGGGATTAGG + Intronic
958936738 3:100263203-100263225 TGTCCCAAGGTGCTCAGTGGGGG + Intronic
959055058 3:101559550-101559572 CCTCCCAAAATGCTGATTATAGG + Intergenic
960095078 3:113681656-113681678 CCTCCCAAAGTGCTGGGATTAGG + Intronic
960387625 3:117038937-117038959 CCTCCCAAAGTGCTGGGATTAGG - Intronic
960690334 3:120340615-120340637 CCTCCCAAAGTGCTGGGATTAGG - Intronic
960806847 3:121592307-121592329 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
961768143 3:129228327-129228349 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
961850394 3:129811522-129811544 CCTCCCAAAGTGCTGGGATTAGG + Intronic
962551113 3:136493083-136493105 CCTCCCAAAGTGCTGTGATTAGG - Intronic
963854368 3:150238697-150238719 CCTACCAATGTGATGAGTGTGGG + Intergenic
964312390 3:155408660-155408682 CCTCCCAAAGTCATGAGAGTGGG - Intronic
964327923 3:155567327-155567349 CCTCCCAAAGTGCTGATTACAGG + Intronic
964713202 3:159694261-159694283 CCTCCCAAAGTGCTGTGATTAGG - Intronic
964803419 3:160580061-160580083 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
964864232 3:161237659-161237681 CCTCCCAAGTAGCTGAGATTTGG + Intronic
965684677 3:171289643-171289665 CCTCCCAAAGTGCTGGGATTAGG - Intronic
965767551 3:172147047-172147069 CCTCCCACGGTGCTGATTACAGG - Intronic
965886587 3:173453352-173453374 CCTCCCAAAGTGCTGGGATTGGG + Intronic
966309070 3:178573623-178573645 CCTCCCAAGTTGCTGAGTTGAGG - Intronic
967194700 3:187016358-187016380 CTTCTCCAGGTGCTGCGTGTGGG - Intronic
967278830 3:187802884-187802906 CCCACCAAGATGCTGAGTCTTGG - Intergenic
967453648 3:189655366-189655388 CCTCCCAAAGTGCTGAGATTAGG - Intronic
967774447 3:193372040-193372062 CCTCCCAAAGTGCTGATTACAGG - Intronic
968055691 3:195690165-195690187 CCTCCCAAAGTGCTGGGACTTGG - Intergenic
968100096 3:195958433-195958455 CCTCCCAAAGTGCTGGGACTTGG + Intergenic
968153741 3:196360765-196360787 CCTCCCAAAGTGTTGAGATTTGG - Intronic
968626860 4:1629694-1629716 CTTCCCAAGGGGCTGAGTCTGGG - Intronic
969279435 4:6160267-6160289 CCTCCCAAATTGCTGGGTGAAGG + Intronic
969414269 4:7048403-7048425 CCTCCCAAGCTGCTGAGTCAGGG + Intronic
969582647 4:8074195-8074217 CCTCCCAAAGTGCTGGGATTAGG - Intronic
970374255 4:15440882-15440904 CCTCCCAAAGTGCTGAGATTTGG - Intronic
970620689 4:17814700-17814722 CCTCCCAAAGTGCTGGTTATAGG + Intronic
971700705 4:29970948-29970970 CCTCCCAAAGTGCTGATTATAGG - Intergenic
972296242 4:37741810-37741832 TCTCCCACGGCACTGAGTGTAGG - Intergenic
972308425 4:37854605-37854627 CCTCCCAAAGTGCAAAGTGCTGG + Intronic
972531972 4:39969408-39969430 CCTCCCAAAGTGCTGGGATTAGG - Intronic
972537527 4:40011860-40011882 CCTCCCAAAGTGCTGAGTGCTGG - Intergenic
972537597 4:40012358-40012380 CCCCCCAAAGTGCTGAGTGCTGG - Intergenic
972707139 4:41556136-41556158 CCTCCCAAAGTGCTGGGATTTGG - Intronic
972980877 4:44699436-44699458 CCTCCCAAAGTGCTGATTACAGG + Exonic
973092074 4:46148968-46148990 CCTCCCAAAGTGCTGATTACAGG + Intergenic
973332597 4:48924451-48924473 CCTCCCAAAGTGCTGGGATTTGG + Intergenic
973906689 4:55539315-55539337 CCTCCCAAAGTGCTGGGTATAGG - Intronic
974855932 4:67460500-67460522 CCTCCCAAGTAGCTGGGAGTAGG - Intergenic
975339163 4:73218384-73218406 CCTCCCAAAGTGCTCAGTAATGG - Intronic
975933425 4:79554166-79554188 GGTCCCAAGGTGCTCAGTGGGGG + Intergenic
976740234 4:88348979-88349001 GCTCACAAGGTGCTCAGTGGGGG + Intergenic
979079880 4:116323606-116323628 CCTCCCAAGTAGCTGAGACTAGG + Intergenic
979253632 4:118590142-118590164 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
979816835 4:125117642-125117664 CCTCCCTGGGTGCTGATGGTTGG + Intergenic
980276787 4:130663119-130663141 TCTCCCAAAGTGCTGAGATTAGG - Intergenic
980673850 4:136048689-136048711 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
981035483 4:140164331-140164353 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
981719766 4:147789528-147789550 CCTCCCAAAGTGCTGATTACAGG + Intronic
982969239 4:161960430-161960452 CCTCCCAAAGTGCTGGGTGCTGG + Intronic
983056606 4:163104088-163104110 GGTCCCAAGGTGCTCAGTGGGGG + Intergenic
984340564 4:178451362-178451384 CCTCCCAAAGTGCTGGATTTCGG - Intergenic
984709408 4:182872667-182872689 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
984797293 4:183674155-183674177 CCTCCCAAAGTGCTGGGATTAGG - Intronic
985495477 5:202326-202348 CCTCCCAAAGTGCTGGGATTAGG - Exonic
985556069 5:558602-558624 CCCTCAGAGGTGCTGAGTGTTGG + Intergenic
985807046 5:2053480-2053502 ACTTCCCAGGTGCTGAGGGTAGG + Intergenic
987121946 5:14776083-14776105 CTTCCCAGGGAGCAGAGTGTGGG + Intronic
987363552 5:17128081-17128103 CATACCAAGGGGCTGAGTATAGG - Intronic
987831937 5:23105598-23105620 CCTCCCAAGGTTCTGAGGATGGG + Intergenic
988089388 5:26516680-26516702 CCTCCCAAAGTGCTGATTACAGG - Intergenic
989013279 5:36898765-36898787 CCTCCCAAAGTGCTGGGTATAGG + Intronic
989056713 5:37372852-37372874 CCTCCCAAAGTGCTGGGTGCTGG - Intergenic
989441292 5:41475056-41475078 CCTCCAAAGGTGCTGTAGGTGGG + Intronic
991084759 5:62638600-62638622 ACTTCCAAGGTGATGAGGGTGGG + Intergenic
991402862 5:66272423-66272445 CCTCCCAAAGTGCTGGGATTCGG + Intergenic
991609427 5:68435248-68435270 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
992142360 5:73811724-73811746 CCTCCCAAAGTGCTGATTACAGG - Intronic
992313428 5:75527256-75527278 CCTCCCACAGTGCTGAGATTAGG - Intronic
992386656 5:76291162-76291184 TCTCTGAAGTTGCTGAGTGTAGG - Intronic
992771587 5:80053818-80053840 CCTCCCAAAGTGCTGGGTTTGGG + Intronic
992984842 5:82217714-82217736 CCTCCCAAAGTGCTGGGTACAGG - Intronic
993271712 5:85805741-85805763 CCTCCCAAAGTGCTGATTACAGG + Intergenic
993720848 5:91320465-91320487 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
994553938 5:101272738-101272760 CCTCCCAAGTAGCTGGGTTTAGG - Intergenic
995013802 5:107287845-107287867 CCTCACCTGGTGCTGACTGTAGG - Intergenic
995038217 5:107559201-107559223 GCTGCAAAGGTGCTGAGTGGTGG - Intronic
995385280 5:111581791-111581813 CCTCCATTGGAGCTGAGTGTAGG - Intergenic
995424840 5:112008910-112008932 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
995507179 5:112872583-112872605 CCTCCCAAAGTGCTGGGATTAGG + Intronic
996699354 5:126434771-126434793 CCTCCCAAAGTGCTGGGCTTAGG + Intronic
996727907 5:126688596-126688618 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
996974961 5:129421100-129421122 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
997020932 5:130001010-130001032 CCTCCCGAGTAGCTGAGTGGTGG + Intronic
997085737 5:130796236-130796258 CTTTCCAATGTGCTGAGTCTAGG - Intergenic
997338210 5:133122527-133122549 CCTCCCAGTGTCCTGAGTTTTGG + Intergenic
997545654 5:134704931-134704953 CCTCCCAAAGTGCTGGGTGCTGG + Intronic
997922304 5:137993522-137993544 CCTCCCAAAGTGCTGGTTATAGG - Intronic
998490387 5:142541317-142541339 ACTCCCAAGGGACTGAGAGTGGG + Intergenic
998869260 5:146536401-146536423 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
998876129 5:146601338-146601360 CCTCCCAAAGTGCTGAATACAGG - Intronic
999141633 5:149366193-149366215 CCACCCAAGGTGCTCAGAATGGG + Intronic
999156127 5:149458706-149458728 CCTCCCAAGGTGGTCACTGGGGG + Intergenic
999788870 5:154918783-154918805 CCTCCCAAAGTACTGATTATAGG - Intronic
999849665 5:155524547-155524569 CCTCCCAAAGTGCCGAGTACAGG - Intergenic
1000929808 5:167237754-167237776 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1001081270 5:168669372-168669394 ACTCCCATGGCGCTGGGTGTTGG - Intronic
1001162025 5:169327854-169327876 CCTCCCAAAGTGCTGATCATAGG - Intergenic
1001653760 5:173332590-173332612 CCTCCCAAAGTGCTGGGAGATGG - Intergenic
1001915140 5:175553989-175554011 CCTCCCAAAGTGCTGAGATTGGG - Intergenic
1002373314 5:178771534-178771556 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1002518854 5:179779111-179779133 CCTCCCAAAGTGCTGTGATTAGG - Intronic
1003714887 6:8635274-8635296 TCTCCCAAGGTGATGATAGTAGG - Intergenic
1004280938 6:14279186-14279208 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1005316834 6:24611240-24611262 CCTCCCAAAGTGCTGGGTGCTGG - Intronic
1005487700 6:26316942-26316964 CCTCCCAATGTGCTGATTACAGG - Intergenic
1005675853 6:28153914-28153936 CCTACCAATGTAATGAGTGTGGG + Exonic
1005768203 6:29036210-29036232 CATCCAAAGGTGCTGTGTGCCGG + Intergenic
1005824063 6:29621903-29621925 CATCCCAAAGTGCTTAGTGCAGG + Intronic
1006200684 6:32287187-32287209 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1006607681 6:35270389-35270411 CCTCCCAAAGTACTGATTATAGG + Intronic
1006624603 6:35388453-35388475 CCTCCCAAAGTGCTGGGTACAGG - Intronic
1006654375 6:35577796-35577818 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1007096561 6:39216863-39216885 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1007114781 6:39335770-39335792 CCTCCCAAGTGGCTGGGTGAAGG + Exonic
1007354728 6:41305776-41305798 CCTCCCAAAGTGCTGATTACAGG + Intergenic
1007490682 6:42219246-42219268 CCTCCCAAAGTGCTGAGTGCTGG - Intergenic
1007556645 6:42771767-42771789 CCTCCCAAGAGGCTGAGCCTGGG - Intronic
1008575782 6:52858813-52858835 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1009197277 6:60702301-60702323 CCTCCCAAAGTGCTGGGGGTTGG + Intergenic
1010040037 6:71370406-71370428 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1010259625 6:73800110-73800132 CCTCCCAAAGTGCTGAACCTTGG + Intronic
1010384343 6:75262088-75262110 CCTCCCAAAGTGCTGAAATTAGG - Intronic
1011057675 6:83223409-83223431 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1011667741 6:89651363-89651385 CCTCCCAAAGTGCTGATTACGGG - Intronic
1013133538 6:107257871-107257893 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1013515474 6:110881557-110881579 CCTCCCAAAGTGCTGGGATTTGG - Intronic
1013945411 6:115716763-115716785 CCTCCCAAAGTGCTGAGATTAGG + Intergenic
1014125553 6:117773027-117773049 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1015266369 6:131295585-131295607 GGTCCCAAGGTGCTCAGTGGGGG - Intergenic
1015267196 6:131300975-131300997 GGTCCCAAGGTGCTCAGTGGGGG - Intergenic
1015301847 6:131661546-131661568 CCTCCCAAAGTGCTGATTACAGG + Intronic
1017079238 6:150651600-150651622 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1017140077 6:151182344-151182366 CCTCCCAAAGTGCTGGGGGTGGG - Intergenic
1017373851 6:153744095-153744117 CCTCCCAAAGTGCTGGGTACAGG + Intergenic
1018751745 6:166812480-166812502 CCTTCCCAGGGGCTGAGTGTGGG + Intronic
1019366755 7:637027-637049 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1020183022 7:5936829-5936851 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1020184153 7:5946205-5946227 CCTCCCAAAGTGCTGATTACAGG + Intronic
1020298764 7:6778561-6778583 CCTCCCAAAGTGCTGATTACAGG - Intronic
1020299890 7:6787928-6787950 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1021173299 7:17420545-17420567 GGTCACAAGGTGCTCAGTGTGGG - Intergenic
1021443721 7:20710116-20710138 TCTCCCAAAGTGCTGGGTGCTGG - Intronic
1022656273 7:32322343-32322365 CCTCCCAAAGTGCTGGTTTTGGG - Intergenic
1022706295 7:32805044-32805066 CCTCCCAAAGTGCTGGGTGCTGG + Intergenic
1023047955 7:36227986-36228008 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1023388762 7:39687169-39687191 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1024119239 7:46220637-46220659 CCACCCAGGGTCCTGAGTGATGG + Intergenic
1024323763 7:48092958-48092980 CCTCCCAAAGTGCTGAGATTAGG + Intronic
1024805326 7:53132658-53132680 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1024941267 7:54765565-54765587 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1025227732 7:57179034-57179056 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1025474704 7:60905023-60905045 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1025480851 7:60981087-60981109 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1025512299 7:61584851-61584873 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1025556856 7:62319901-62319923 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1025837851 7:65112413-65112435 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1025879418 7:65520673-65520695 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1025885217 7:65583578-65583600 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1026498210 7:70921560-70921582 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1026817514 7:73523765-73523787 CCTCCCAAAGTGCTGAGATTAGG + Intergenic
1027758011 7:82240710-82240732 CCTCCCAAAGTGCTGAGATTGGG - Intronic
1028932822 7:96431963-96431985 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1029136807 7:98378795-98378817 CCTCCCAAAGTGCTGAGCCATGG - Intronic
1029638582 7:101803168-101803190 CCTCCCAAGTAGCTGAGACTAGG - Intergenic
1030118497 7:106082932-106082954 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1030261427 7:107568946-107568968 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1030822631 7:114113758-114113780 CCTCCCAAAGTGCTGGGTTAAGG + Intronic
1030827421 7:114176595-114176617 CCTCCCAGAGTGTTGGGTGTTGG + Intronic
1032156463 7:129473483-129473505 CTTCCCAAGTAGCTGGGTGTAGG + Intronic
1032226865 7:130039086-130039108 CCTCCCAAAGTGCTGGGATTGGG - Intronic
1033130375 7:138740696-138740718 CCTCCCAAAGTGCTGGGATTTGG + Intronic
1033334523 7:140441061-140441083 CCTCCCAAGGTGCTGGGATTTGG + Intergenic
1033334536 7:140441149-140441171 TCTCCCAAAGTGCTGATTATAGG - Intergenic
1033706460 7:143890256-143890278 CCTCCCAAAGTGCTGGGAGAAGG + Intronic
1033921456 7:146398126-146398148 CCTTCCAAAGTGCAGAGTGCAGG + Intronic
1034085793 7:148321272-148321294 CCAACCAATGTGTTGAGTGTAGG + Intronic
1034302331 7:150027525-150027547 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1034638015 7:152582603-152582625 CCTCCCAAGAAGCTGGGTGAAGG - Intergenic
1034803729 7:154069793-154069815 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1035838833 8:2788515-2788537 TCTCCCAAGGCGCTGGATGTAGG - Intergenic
1036088170 8:5636205-5636227 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1036447731 8:8837382-8837404 CCTCCCAAAGTGTTGAGATTAGG - Intronic
1036555624 8:9857198-9857220 CCTCCCAAAGTGCTGGGATTGGG + Intergenic
1037613341 8:20495140-20495162 CCTCCCAAAGTGCTGATTAGAGG - Intergenic
1037680100 8:21090053-21090075 CCTCCCAAAGTGCTGAGATTAGG + Intergenic
1038278240 8:26139704-26139726 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1038493595 8:27986646-27986668 TCCCACAAGGCGCTGAGTGTAGG - Intronic
1038847897 8:31246710-31246732 CCTCCCAAAGTGCTGTGGGCTGG + Intergenic
1039191602 8:34982642-34982664 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1039295717 8:36150636-36150658 CCTCCCAAGGCTCTGATTGCAGG + Intergenic
1039583670 8:38687351-38687373 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1039650314 8:39334339-39334361 CCTCCCAAAGTGCTGATTACAGG - Intergenic
1039704789 8:39995536-39995558 CCTCCCAAAGTGCTGGGTGTGGG + Intronic
1039773552 8:40713650-40713672 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1039814862 8:41084375-41084397 CCTCCCAAAGTGCAAAGTGCTGG - Intergenic
1040004432 8:42607556-42607578 CCTCCCAAAGTGCAAAGTGCTGG + Intergenic
1040119991 8:43673300-43673322 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1040313346 8:46248149-46248171 CCTCCCAAAGTGCTGAGCCAAGG - Intergenic
1040444725 8:47482262-47482284 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1040656436 8:49515761-49515783 TCTCCCAAGGTGCTGGGATTAGG - Intergenic
1040932173 8:52746881-52746903 CCTCCCAAAGTGCTAAGTACAGG - Intergenic
1041061451 8:54038639-54038661 CCTCCCAAAGTTCTGAGTGGTGG + Intergenic
1042095450 8:65211066-65211088 CCTGCGAAGGTGCTGTATGTTGG - Intergenic
1042234158 8:66591090-66591112 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1042317829 8:67443182-67443204 CCTCCCAAGTAGCTGAGATTAGG + Intronic
1042369713 8:67977665-67977687 CCTCCCCAGAGGTTGAGTGTGGG - Intronic
1042702503 8:71631547-71631569 CCTCCCCATTTGCTCAGTGTTGG + Intergenic
1042886929 8:73562852-73562874 CCTTCCAAAGTGCTGATTATAGG - Intronic
1042961352 8:74306851-74306873 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1044232492 8:89795319-89795341 CCTCCCAAAGTGCAAAGTGCTGG + Intergenic
1045116987 8:98993080-98993102 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1045533319 8:103004367-103004389 GCTCACAAGGTGCTCAGTGGGGG - Intergenic
1048217208 8:132507310-132507332 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1048400313 8:134060936-134060958 CCTCCCAAAGTGCTGGGATTGGG - Intergenic
1048421157 8:134279583-134279605 CCTTCACAGGTGCTGAGTGGGGG - Intergenic
1048719851 8:137311467-137311489 CCTCCCAAAGTGCTGAGATTAGG - Intergenic
1048787253 8:138063429-138063451 CCTCCCTTGATGCTGTGTGTGGG - Intergenic
1048999469 8:139815646-139815668 CCTCCCAAAGTGCTGATTACAGG + Intronic
1049294212 8:141821963-141821985 CCTGCCATGGTTCTGTGTGTAGG - Intergenic
1049711641 8:144066698-144066720 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1049841261 8:144774094-144774116 CCTACAAATGTGATGAGTGTGGG - Exonic
1049971245 9:824009-824031 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1050215688 9:3320428-3320450 CCTCCCAAGTAGCTGAGTACAGG - Intronic
1050323753 9:4480009-4480031 CCTCCCAAAGTGCTGAGTGCTGG + Intergenic
1050338876 9:4616018-4616040 CCTCCCAAAGTGCTGGGTACAGG - Intronic
1050355846 9:4782012-4782034 CCTCCCAAAGAGCTGGATGTTGG + Intergenic
1050461353 9:5880255-5880277 CCTCCCAAAGTGCTGGGATTTGG - Intergenic
1050555487 9:6785870-6785892 ACACCCAGTGTGCTGAGTGTTGG + Intronic
1051286075 9:15498157-15498179 CCTCCCAAAGTGCTGGGGCTGGG - Intronic
1051289502 9:15530713-15530735 CCTCCCAAAGTGCTGGGGCTGGG - Intergenic
1051621045 9:19049598-19049620 CCTCCCTCGGCGCTGCGTGTAGG + Exonic
1051640305 9:19218547-19218569 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1051664196 9:19452892-19452914 CCTCCCAAAGTGCTGGGAATAGG + Intergenic
1052754263 9:32524855-32524877 CCTCCCAAAGTGCTGGCTGCAGG + Intronic
1052946499 9:34172752-34172774 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1052961572 9:34302247-34302269 CCTCCCAAAGTGCTGATTACAGG + Intronic
1053167958 9:35857976-35857998 CCTTCCACTGTGCTGAGTGCTGG - Intergenic
1053692969 9:40605817-40605839 CCTCCCAGAGTGCTGGGTATGGG - Intergenic
1053698500 9:40662402-40662424 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1053944500 9:43292637-43292659 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1054271866 9:63034273-63034295 CCTCCCAGAGTGCTGGGTATGGG + Intergenic
1054304210 9:63405048-63405070 CCTCCCAGAGTGCTGGGTATGGG - Intergenic
1054309789 9:63461803-63461825 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1054402954 9:64729061-64729083 CCTCCCAGAGTGCTGGGTATGGG - Intergenic
1054408577 9:64785953-64785975 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1054436577 9:65214551-65214573 CCTCCCAGAGTGCTGGGTATGGG - Intergenic
1054441732 9:65269768-65269790 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1054488552 9:65751730-65751752 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1054493821 9:65807443-65807465 CCTCCCAGAGTGCTGGGTATGGG + Intergenic
1055950422 9:81724965-81724987 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1056420305 9:86419170-86419192 CCTCCCAAAGTGCTGGTTATAGG - Intergenic
1056882665 9:90412922-90412944 GGTCCCAAGGTGCTCAGTGGGGG - Intergenic
1056983193 9:91336371-91336393 CCTCCCAAAGTGTTGGGAGTAGG - Intronic
1057234492 9:93347816-93347838 GGTCCCAAGGTGCTCAGTGGGGG - Intergenic
1057235304 9:93353128-93353150 GGTCCCAAGGTGCTCAGTGGGGG - Intergenic
1057793281 9:98138156-98138178 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1057821309 9:98333185-98333207 GCTCTCCAGGTGCTGGGTGTGGG + Intronic
1058283066 9:103142604-103142626 CCTCCCAAGTAGCTGGGTATAGG - Intergenic
1058978380 9:110146152-110146174 CCTCCCAAAGTGCTGGGATTTGG + Intronic
1059134007 9:111786177-111786199 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1059295385 9:113265631-113265653 CCTCCCAAAGTGCTGGGATTGGG + Intronic
1059989411 9:119850999-119851021 CCTCCCAAGCTGGTAAGTTTTGG - Intergenic
1060041674 9:120305902-120305924 CCTCCCTATGTGCAGACTGTGGG + Intergenic
1060394553 9:123306315-123306337 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1060841017 9:126793202-126793224 CCTCCCAAAGTGCTGAGATTGGG - Intergenic
1060897618 9:127227658-127227680 CCTCCCAATGCATTGAGTGTAGG - Intronic
1060948696 9:127586767-127586789 CCTACCCAGGTGTTCAGTGTGGG + Intergenic
1061059500 9:128243481-128243503 CCTCCCAAGGTGGAGAGTTGGGG - Intronic
1061200046 9:129132746-129132768 CCTCCCAAAGTGCTGGGACTGGG + Intronic
1061376334 9:130226899-130226921 CCTCCCAAGTAGCTGAGACTAGG - Intronic
1061722195 9:132559086-132559108 CCTCCCAAAGTGCTGATTACAGG - Intronic
1062237018 9:135515191-135515213 CTTCCCCAGGTGCAGAGTGAGGG + Intergenic
1202780863 9_KI270717v1_random:35607-35629 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1203581665 Un_KI270746v1:12461-12483 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1203587636 Un_KI270747v1:21215-21237 CCTCCCAAAGTGCTGGGATTAGG - Intergenic
1203623665 Un_KI270749v1:148481-148503 CCTCCCAAAGTGCTGGATATGGG - Intergenic
1185469208 X:372700-372722 CCTTCCAAAGTGCTGGGAGTAGG - Intronic
1185730207 X:2455483-2455505 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1186387120 X:9121172-9121194 CCTCCCAAAGTGCTGGGATTAGG - Intronic
1186437371 X:9554135-9554157 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1186876549 X:13823774-13823796 CCTCCCAAAGTGCTGCGATTAGG + Intronic
1186954896 X:14670864-14670886 CCTCCTAAGGAGCTCAGGGTGGG + Intronic
1187327683 X:18307024-18307046 CCTCCCAAAGTGCTGAATTAGGG - Intronic
1187418303 X:19112701-19112723 CCTCCCAAAGTGCTGAGTGCTGG - Intronic
1187924791 X:24239774-24239796 CCTCCCAAAGTGCTGGGATTAGG + Intergenic
1188003264 X:25001400-25001422 CCTCCCCAAGTGCTGAATGATGG - Intergenic
1189816924 X:44833530-44833552 CCTCCCAAATTGCTGGGTGTGGG + Intergenic
1189836332 X:45027050-45027072 CCTCCGAAAGTGCTGGGTGCTGG - Intronic
1190052571 X:47161786-47161808 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1190146988 X:47902795-47902817 CCTCCCAAAGTGCTGATTACAGG - Intronic
1190226984 X:48553878-48553900 CCTCCCAAAGTGCTGGGATTAGG + Intronic
1190325113 X:49201864-49201886 ACTCCCAAAGTGCTCATTGTTGG + Intergenic
1190421204 X:50286552-50286574 CCTCCCAAAGTGCTGGGATTGGG + Intronic
1190466350 X:50728101-50728123 CCTCCCAAAGTGCTGGGATTTGG - Intronic
1191161869 X:57338263-57338285 GGTCGCAAGGTGCTCAGTGTGGG + Intronic
1192480078 X:71477544-71477566 CCTTCCAAAGTGCTAAGTGCTGG + Intronic
1196351459 X:114735854-114735876 CCTCCCAAAGTGCTGATTACAGG - Intronic
1196870966 X:120113381-120113403 CCTCCCAAAGTGCTGGGATTTGG + Intronic
1196992325 X:121344095-121344117 GGTCACAAGGTGCTCAGTGTGGG + Intergenic
1197304143 X:124820041-124820063 CCTCCCAAAGCGCTGGGTGCTGG + Intronic
1198192351 X:134320704-134320726 CCTCCCAAAGTGCTGGCTGGAGG + Intergenic
1198399194 X:136252839-136252861 CCTCCCAAAGTGCTGGGGCTGGG - Intronic
1198568582 X:137931786-137931808 CCTCCCAAAGTGCTGGGAGGAGG - Intergenic
1199152475 X:144503820-144503842 CCTCCCAAAGTGCTGGGATTTGG + Intergenic
1201420255 Y:13790561-13790583 TTTCCCAAAGTGCTGATTGTTGG + Intergenic