ID: 1072328121

View in Genome Browser
Species Human (GRCh38)
Location 10:94318625-94318647
Sequence CCCACACTCAGCACCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328114_1072328121 10 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data
1072328113_1072328121 11 Left 1072328113 10:94318591-94318613 CCCAAGCTGAAATTGTGTCCATC 0: 1
1: 0
2: 1
3: 12
4: 160
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data
1072328116_1072328121 -7 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data
1072328110_1072328121 27 Left 1072328110 10:94318575-94318597 CCACCATCCTGTGCTACCCAAGC 0: 1
1: 0
2: 1
3: 19
4: 257
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data
1072328111_1072328121 24 Left 1072328111 10:94318578-94318600 CCATCCTGTGCTACCCAAGCTGA 0: 1
1: 0
2: 4
3: 27
4: 315
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data
1072328112_1072328121 20 Left 1072328112 10:94318582-94318604 CCTGTGCTACCCAAGCTGAAATT 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1072328121 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328121 Original CRISPR CCCACACTCAGCACCTTGGG AGG Intronic
No off target data available for this crispr