ID: 1072328122

View in Genome Browser
Species Human (GRCh38)
Location 10:94318626-94318648
Sequence TCCTCCCAAGGTGCTGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 0, 3: 45, 4: 325}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328122_1072328132 16 Left 1072328122 10:94318626-94318648 CCACACTCAGCACCTTGGGAGGA 0: 1
1: 0
2: 0
3: 45
4: 325
Right 1072328132 10:94318665-94318687 AGGCTAGAGGGAAGACAGGCTGG No data
1072328122_1072328130 4 Left 1072328122 10:94318626-94318648 CCACACTCAGCACCTTGGGAGGA 0: 1
1: 0
2: 0
3: 45
4: 325
Right 1072328130 10:94318653-94318675 GAGGCAGTGGGTAGGCTAGAGGG No data
1072328122_1072328127 -8 Left 1072328122 10:94318626-94318648 CCACACTCAGCACCTTGGGAGGA 0: 1
1: 0
2: 0
3: 45
4: 325
Right 1072328127 10:94318641-94318663 TGGGAGGAGCAGGAGGCAGTGGG No data
1072328122_1072328131 12 Left 1072328122 10:94318626-94318648 CCACACTCAGCACCTTGGGAGGA 0: 1
1: 0
2: 0
3: 45
4: 325
Right 1072328131 10:94318661-94318683 GGGTAGGCTAGAGGGAAGACAGG No data
1072328122_1072328128 -4 Left 1072328122 10:94318626-94318648 CCACACTCAGCACCTTGGGAGGA 0: 1
1: 0
2: 0
3: 45
4: 325
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data
1072328122_1072328129 3 Left 1072328122 10:94318626-94318648 CCACACTCAGCACCTTGGGAGGA 0: 1
1: 0
2: 0
3: 45
4: 325
Right 1072328129 10:94318652-94318674 GGAGGCAGTGGGTAGGCTAGAGG No data
1072328122_1072328126 -9 Left 1072328122 10:94318626-94318648 CCACACTCAGCACCTTGGGAGGA 0: 1
1: 0
2: 0
3: 45
4: 325
Right 1072328126 10:94318640-94318662 TTGGGAGGAGCAGGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328122 Original CRISPR TCCTCCCAAGGTGCTGAGTG TGG (reversed) Intronic
900485420 1:2920476-2920498 TCCTCCCCAGGTCCTGAGCACGG - Intergenic
900863992 1:5254317-5254339 TCCTCACAAGATGCTCCGTGTGG + Intergenic
901313275 1:8286529-8286551 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
901931790 1:12600660-12600682 TCCTTCCAAGGTGGTTGGTGAGG - Intronic
902407646 1:16194237-16194259 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
902951767 1:19889747-19889769 TGCTCCCTGGGTGCTAAGTGAGG + Intronic
903427261 1:23263343-23263365 TCCTTCCAAAGAGCTGAGGGAGG - Intergenic
903787028 1:25868131-25868153 TCCCCCCAAGGTTCTCAGTTGGG - Intronic
904419531 1:30382712-30382734 TCCTCCTGAGGTGCTGACTGAGG - Intergenic
904531592 1:31173480-31173502 GCCTCCCAAAGTGCTGGGAGAGG + Intergenic
905196037 1:36278016-36278038 GCCTCTCAAAGTGCTGAGTGGGG + Intronic
905215579 1:36405111-36405133 TCCTCCCATGCTGTTGAGTCCGG + Intergenic
905298524 1:36970287-36970309 TCTTCCACAGGTGATGAGTGGGG + Intronic
905405531 1:37729918-37729940 TTCTCCCAATCTGCAGAGTGTGG - Intronic
906134962 1:43492248-43492270 TACTGCCAAGCTGATGAGTGGGG + Intergenic
906252486 1:44321411-44321433 TCCTTCCAAGGTGAAGAGAGGGG + Intronic
906417699 1:45634086-45634108 TTCTCCCAAAGAGGTGAGTGAGG - Exonic
908701137 1:66902040-66902062 GCCTCCCAAAGTGCTGAGTCTGG + Intronic
911153804 1:94620379-94620401 TCCTCCTAACATGCTTAGTGAGG + Intergenic
912940113 1:114037304-114037326 GCGTCGCAAGGTGCTCAGTGGGG - Intergenic
913105904 1:115613790-115613812 TCCACCCCAGGTGCTATGTGGGG - Intergenic
913244584 1:116860381-116860403 TGGTCACAAGGTGCTCAGTGGGG + Intergenic
913376578 1:118159100-118159122 TCCTTCCAAAGTGCTGAGTTTGG - Intronic
913388025 1:118280772-118280794 GCCTCCCAAGGTGTTGTGTTGGG - Intergenic
914051156 1:144133494-144133516 GCCTCCCAAAGTGCTGGGTATGG + Intergenic
914128025 1:144831948-144831970 GCCTCCCAAAGTGCTGGGTATGG - Intergenic
914359500 1:146920784-146920806 TTCTGCCAAGGAGTTGAGTGTGG + Intergenic
914494250 1:148179091-148179113 TTCTGCCAAGGAGTTGAGTGTGG - Intergenic
914889013 1:151606443-151606465 CCCTCTCTAGGTGCTCAGTGTGG - Intergenic
917534929 1:175867653-175867675 TCTTCCCACAGTGCTGAGTGTGG + Intergenic
917566577 1:176218417-176218439 TAATCCCCAGGTGCTGAGGGAGG + Intergenic
919803583 1:201367708-201367730 TCCTCCAAAGCTGCTGTGAGGGG + Intronic
920153832 1:203932261-203932283 TCCACCCAAGGTGTTGACTGAGG - Intergenic
921936332 1:220800384-220800406 TTCTCCTAAGGAGCTCAGTGTGG + Intronic
923674009 1:236064896-236064918 TCCTGCCCTGGAGCTGAGTGGGG - Exonic
923963247 1:239106853-239106875 TCGTCACAAGGTGCTCAGTAGGG - Intergenic
1062833507 10:621762-621784 TCATGCCAAGGTGCTGAGCACGG + Intronic
1063710392 10:8471689-8471711 TCCTCCCCAGGTGGGGAGTTTGG - Intergenic
1063964135 10:11332665-11332687 TCCTAACAGGGTGCTGAGCGGGG - Exonic
1064008331 10:11715323-11715345 ACCTCCCAAAGTGCTGATTGCGG - Intergenic
1064420837 10:15189442-15189464 ACCTCCCAAAGTGCTGGGCGAGG + Intergenic
1065379886 10:25079275-25079297 TCCCCCCACGGTGCACAGTGTGG + Intergenic
1065887235 10:30089237-30089259 TCTTCCCTAGGTGGTGAGGGTGG + Intronic
1067246771 10:44554008-44554030 TCTTCCCAGGGTGCTGAGAGAGG + Intergenic
1067565348 10:47332113-47332135 GCCTCCCCAGGTGCAGAGTGAGG + Intergenic
1068592994 10:58869268-58869290 TCCTCACTATGTGATGAGTGAGG - Intergenic
1070201119 10:74207337-74207359 TGCCTGCAAGGTGCTGAGTGGGG + Intronic
1070276779 10:75014870-75014892 TGCATCCAAGGAGCTGAGTGAGG + Intronic
1071436595 10:85653447-85653469 TCCTGCCAAGGAGCTGAGACAGG + Intronic
1072328122 10:94318626-94318648 TCCTCCCAAGGTGCTGAGTGTGG - Intronic
1073841992 10:107508346-107508368 TCCACCCAAGGTGCAGACAGGGG + Intergenic
1074351875 10:112745783-112745805 TCCTTCCAAGGTCCTGAAAGAGG - Intronic
1074721651 10:116270705-116270727 TTCTCCCCAGCTGCAGAGTGAGG - Intronic
1075792844 10:125097859-125097881 GCCTCCCAAGGTGCTGTGCTGGG - Intronic
1076121250 10:127938410-127938432 TCCTCCCAAGGTGCTGGGACAGG - Intronic
1077081902 11:728092-728114 CCCACGCAGGGTGCTGAGTGTGG - Intergenic
1077592077 11:3500097-3500119 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
1077679456 11:4225061-4225083 GGCTCACAAGGTGCTCAGTGGGG + Intergenic
1077688874 11:4321645-4321667 GGCTCACAAGGTGCTCAGTGGGG + Intergenic
1077694127 11:4378203-4378225 TCTTCCCAAGAAGCTGAATGGGG - Intergenic
1077784518 11:5367936-5367958 TCCTCACAAACTGCTGAGTAAGG - Intronic
1079530475 11:21446808-21446830 GCCTCACAATGTGCTGATTGTGG - Intronic
1080934756 11:36851062-36851084 TCTATCCAAGGTCCTGAGTGTGG + Intergenic
1081491560 11:43573305-43573327 TCCTCCAAAGGACCTGACTGAGG + Intronic
1083312958 11:61794673-61794695 TCCTCCCCAGGTCCTGATTTAGG - Intronic
1085458961 11:76681647-76681669 TCATCCCAACGTGCTGTGGGAGG - Intergenic
1087767698 11:102174341-102174363 GCCTCCCAAAGTGCTGGGAGTGG - Intronic
1089164251 11:116462437-116462459 TCCCCCAAGGATGCTGAGTGGGG + Intergenic
1089544245 11:119210702-119210724 GCCTCCCAAAGTGCTGAGGTGGG + Intronic
1089881075 11:121774307-121774329 GCCTCCCAAAGTGCTGAGATAGG - Intergenic
1090207635 11:124894717-124894739 TCCTAACAAGGTCCTGGGTGAGG + Intronic
1090487846 11:127130225-127130247 GCCTCCCAAGGTGCTGGAAGAGG + Intergenic
1090501162 11:127262772-127262794 TTATGCCAACGTGCTGAGTGTGG + Intergenic
1090790110 11:130085157-130085179 ACCTCCCAACAGGCTGAGTGCGG + Intronic
1094022530 12:25929499-25929521 TCCTCCCAAGGTCCTGCAGGTGG - Intergenic
1094192646 12:27712724-27712746 CCCTGCCAAGGGGCTGAGTGTGG + Intronic
1095676782 12:44928994-44929016 TCATCCCAAGGAGATGAGTTTGG - Intergenic
1095790154 12:46158143-46158165 TCCTACCAAAGGTCTGAGTGGGG - Intergenic
1096245668 12:49984208-49984230 TCCTCCCAGGGAGCTGGCTGTGG - Intronic
1096514348 12:52148008-52148030 TCCTCCTCAGGTGCTCTGTGTGG + Intergenic
1096682746 12:53267792-53267814 GCCTCCCAAAGTGCTGACTACGG - Intergenic
1100640454 12:96477441-96477463 GCCTCCCAAAGTGCTGAGCCAGG - Intergenic
1100920401 12:99478206-99478228 CCCTCCCAAGATGTTGAGAGGGG + Intronic
1102586320 12:113925579-113925601 TCCACTCAAGGTGCTGAGACAGG + Intronic
1103420734 12:120780215-120780237 TCCTCCCAAAGTGCTGGGATGGG - Intronic
1104931692 12:132342478-132342500 TCCTCTCAAGGGGCTGAGGGTGG - Intergenic
1106174790 13:27320987-27321009 TGCACCCAGGGTGCTCAGTGCGG + Intergenic
1107909098 13:45088640-45088662 TCCTCCCAAGTAGCTGAGATTGG + Intergenic
1110395134 13:75021210-75021232 TCCTCAGAAGGAGCTGAGTAGGG - Intergenic
1110450418 13:75634180-75634202 GCCTCCCAAAGTGCTGAGCCTGG - Intronic
1111302499 13:86363915-86363937 GGATCCCAAGGTGCTCAGTGGGG - Intergenic
1111631243 13:90848772-90848794 GGGTCCCAAGGTGCTCAGTGGGG + Intergenic
1113495274 13:110723160-110723182 GGCTCCCCAGGTGCTGAGAGAGG + Intronic
1113651436 13:112036607-112036629 CCCTCCCTTGGCGCTGAGTGGGG - Intergenic
1114470715 14:22959021-22959043 GCCTCCCAAAGTGCTGGGTCAGG - Intronic
1117422759 14:55563545-55563567 TCTTTCCAAGGGGCAGAGTGGGG - Intronic
1119828881 14:77683105-77683127 ACCTCCCAGAGTGCTAAGTGAGG + Intronic
1120836099 14:89039724-89039746 TCTTCCCAAGTGGCTGGGTGCGG - Intergenic
1120982986 14:90307618-90307640 GCCTCCCAAAGTGCTGAGGCGGG - Intronic
1122066570 14:99177960-99177982 TCCATCCAAGGTCTTGAGTGTGG + Intronic
1122453470 14:101831131-101831153 TTCTCCCCAGGTGTGGAGTGAGG - Intronic
1122475421 14:102005094-102005116 TCCGCCCATGCTGCTCAGTGCGG - Exonic
1202903142 14_GL000194v1_random:54562-54584 TCCCCCACAGGTGCTGAGAGGGG - Intergenic
1124626799 15:31312371-31312393 TCCTCGCAAGGGGCTGCGTTGGG + Intergenic
1125512509 15:40300057-40300079 GCCTCCCAAAGTGCTGTGTGGGG - Intronic
1125586446 15:40823901-40823923 GCCTCCCAAAGTGCTGGGAGGGG - Intronic
1126423016 15:48495149-48495171 TCCTCCCTCGGTGCTGCGTGGGG - Exonic
1126457903 15:48884608-48884630 TCCTCCCCAGGTGCTGGGAGTGG + Intronic
1127332901 15:57956049-57956071 TCCTCCCAGTGTGATAAGTGTGG - Intronic
1129371869 15:75101884-75101906 TCCTCCCAAAGTGCTGAGACAGG + Intronic
1130540571 15:84818118-84818140 TCCTCCCCAGGACCTGAGTGGGG + Intronic
1131089370 15:89609728-89609750 GCCTCCCAAAGTGCTGAGATAGG + Intronic
1131427703 15:92360450-92360472 TTCTCCCAAGGTGATGACTGCGG - Intergenic
1132084342 15:98894778-98894800 GCCTCCCAAGGTGCTGAGATAGG - Intronic
1132712220 16:1274116-1274138 TCCTGCCATGGTGCTGGTTGGGG - Intergenic
1133311521 16:4849850-4849872 GCCTCCCAAAGTGCTGGGTCCGG + Intronic
1133858826 16:9575028-9575050 TCCTTCAAAGCTGCAGAGTGTGG + Intergenic
1135155808 16:20051692-20051714 TCCTCCCAGGGTGCAGAGGTGGG - Intronic
1136721990 16:32328228-32328250 GCCTCCCAAAGTGCTGGGTATGG + Intergenic
1136840314 16:33534191-33534213 GCCTCCCAAAGTGCTGGGTATGG + Intergenic
1137582712 16:49643554-49643576 TCCTCCCAAAGTGGGGGGTGGGG - Intronic
1137790787 16:51173000-51173022 GCCTCCCTAGGTGCTGATTTAGG + Intergenic
1138486851 16:57350958-57350980 GCCTCCCAAAGTGCTGGGTAAGG + Intergenic
1138932119 16:61671685-61671707 TCCTCCCAGGTTGCTGAGAACGG + Intronic
1139281828 16:65777360-65777382 TGATTGCAAGGTGCTGAGTGAGG - Intergenic
1139954063 16:70685113-70685135 TCCTCCCAAGGTGATGATCAAGG + Intronic
1140345389 16:74208346-74208368 GCCTCCCAAAGTGCTGAGATGGG - Intergenic
1141701093 16:85642482-85642504 TCCTTCCAAGGGGCTGAGACAGG + Intronic
1141955737 16:87370273-87370295 CCATCCCAGTGTGCTGAGTGCGG - Intronic
1142311631 16:89317536-89317558 TCCTTCCCAGGTGGTGAGTGGGG - Intronic
1203004441 16_KI270728v1_random:189546-189568 GCCTCCCAAAGTGCTGGGTATGG - Intergenic
1203136051 16_KI270728v1_random:1725977-1725999 GCCTCCCAAAGTGCTGGGTATGG - Intergenic
1203150480 16_KI270728v1_random:1834484-1834506 GCCTCCCAAAGTGCTGGGTATGG + Intergenic
1143923981 17:10353206-10353228 GCCTCTCCAGGTGCTGAGTGTGG + Intronic
1143940714 17:10538384-10538406 GCCTCCCAAAGTGCTGTTTGGGG - Intronic
1146883442 17:36456113-36456135 CCTTCCCAAAGTGCTGACTGTGG - Intergenic
1147738213 17:42654378-42654400 GCCTCCCAAGGAGCTGGGTGGGG + Intergenic
1148764446 17:50028995-50029017 TCCTCCCAAGGGCCTTAGTGGGG + Intergenic
1149384068 17:56124701-56124723 TCCATCCAAGGGGCAGAGTGAGG - Intronic
1152755438 17:82085182-82085204 ACCTCCCAACTTGCCGAGTGTGG - Intronic
1152877605 17:82795981-82796003 GCCTACCAAGGTGGTGGGTGAGG + Intronic
1153688368 18:7567805-7567827 TCCCCTCATGGTGCTGAGTGCGG - Exonic
1154332604 18:13442231-13442253 TGCTATCAAGGTGCTGAGAGTGG + Intronic
1154412151 18:14147254-14147276 TCCTCCCCTGGTGCTCACTGGGG + Intergenic
1155215177 18:23636827-23636849 GCCTCCCAAAGTGCTAGGTGTGG + Intronic
1156348535 18:36282251-36282273 TGCTCTTAAGGAGCTGAGTGAGG + Intergenic
1157362380 18:47031732-47031754 GCCTCCCAAAGTGCTGAGGTAGG + Intronic
1157500002 18:48183674-48183696 TACTCCCCAGCTGCTGAGTGTGG + Intronic
1157886299 18:51370077-51370099 TCATCCCAATGTGATGAATGAGG - Intergenic
1158354309 18:56599679-56599701 GCCTCCCAAGTAGCTGGGTGTGG + Exonic
1158577041 18:58646541-58646563 GCGTCACAAGGTGCTCAGTGGGG + Intergenic
1160546088 18:79657026-79657048 GCCTGGCCAGGTGCTGAGTGTGG - Intergenic
1161249162 19:3271140-3271162 TCTGCCCAAGGTGCTGGGAGGGG + Intronic
1161768718 19:6220188-6220210 TCCTCCCCAGAGGCTGTGTGTGG - Intronic
1163437675 19:17305024-17305046 TCCTCTCCAAGGGCTGAGTGAGG - Intronic
1163747820 19:19058480-19058502 TCCTCCTAAAGTGAGGAGTGGGG + Intronic
1163809173 19:19419769-19419791 GCCTCCCAAAGTGCTGAGACAGG + Intronic
1164202881 19:23033047-23033069 TGGTCACAAGGTGCTCAGTGGGG - Intergenic
1165508136 19:36247920-36247942 GCCTCCCAAGTAGCTGGGTGTGG - Intergenic
1165727451 19:38123119-38123141 ACCACCCAAGGTGCTGAGCAGGG - Intronic
1166806002 19:45487684-45487706 GCCTCCCAAAGTGCTGAGATTGG - Intronic
1168237476 19:55072296-55072318 TCCTCCCAATAAGCTGGGTGTGG + Intronic
1168665081 19:58198920-58198942 CCCTCCCAAGGTGCTGAGATGGG - Intronic
1202690563 1_KI270712v1_random:86134-86156 GCCTCCCAAAGTGCTGGGTATGG + Intergenic
925176347 2:1786746-1786768 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
925752299 2:7099734-7099756 TAATCCCCAGGTGCTGAGGGAGG + Intergenic
925860584 2:8171898-8171920 CCCTCCCCAGGTGCTTAGAGGGG - Intergenic
927063005 2:19441874-19441896 TACTCACAAGGTGCTGGGTGTGG - Intergenic
927591662 2:24362078-24362100 TCCTCCCAAAGTGCTGGGATTGG + Intergenic
928538599 2:32263247-32263269 ACCTCATAAGGTGCAGAGTGAGG - Intronic
928640647 2:33295268-33295290 GCCTCCCAAAGTGCTGTGTCCGG - Intronic
929119104 2:38469234-38469256 TCCTCCCAAGGTGGTAAGTAGGG - Intergenic
929623448 2:43381424-43381446 TTCTCCCAAGCCCCTGAGTGTGG + Intronic
932596494 2:73096781-73096803 GCCCCAAAAGGTGCTGAGTGAGG - Intronic
933199764 2:79435496-79435518 TCCACTCAAGTTGCTGTGTGAGG + Intronic
933829807 2:86197772-86197794 GCCTCCCAAAGTGCTGGGAGAGG - Intergenic
933955850 2:87369870-87369892 GCCTCCCAAAGTGCTGGGTATGG - Intergenic
934240003 2:90261905-90261927 GCCTCCCAAAGTGCTGGGTATGG - Intergenic
934273188 2:91554849-91554871 GCCTCCCAAAGTGCTGGGTATGG + Intergenic
934324104 2:91994605-91994627 GCCTCCCAAAGTGCTGGGTATGG - Intergenic
934462456 2:94225171-94225193 GCCTCCCAAAGTGCTGGGTATGG - Intergenic
934503525 2:94875837-94875859 TCCCCCGCAGGTGCTGAGAGGGG + Intronic
935516552 2:104047395-104047417 TCCTCTCTAGTTGCTGATTGTGG + Intergenic
936060560 2:109293173-109293195 GCCTCCGATGGTGCTGTGTGGGG + Intronic
937315311 2:120928266-120928288 TCATGCCAAGGTGCTGTCTGTGG + Intronic
938596492 2:132792730-132792752 TTCTCCCAAGGTATTGAGGGAGG + Intronic
938957049 2:136308403-136308425 TGCTCCCAAGCTGCCGAGTTGGG - Intergenic
939865258 2:147465308-147465330 TCCTGCCAATGTCCTCAGTGAGG - Intergenic
940864653 2:158805966-158805988 TCCTCCCAAGGCCCTGGGAGGGG - Intronic
941614253 2:167701129-167701151 TCTTGCCAAGCTGCTGAGTGAGG - Intergenic
943062041 2:183049432-183049454 GCGTCACAAGGTGCTCAGTGGGG - Intergenic
945868570 2:215202998-215203020 TCCCCCCTAGATGCTGCGTGTGG - Intergenic
945926232 2:215807327-215807349 TGTTCCCCAGGTGCTTAGTGAGG + Intergenic
946392657 2:219425939-219425961 TCCTCCCCAGGTCGTCAGTGAGG + Exonic
947183913 2:227437951-227437973 TCCTCCCAAAGTGCTGGGTCAGG - Intergenic
947619749 2:231582211-231582233 GCCTCCCAAAGTGCTGAGACAGG - Intergenic
947798868 2:232914445-232914467 GCCTCCCAAAGTGCTGAGACAGG - Intronic
947873493 2:233452984-233453006 TCCTCCCCTGGGGCTGCGTGGGG + Intronic
948334547 2:237197247-237197269 TCCTCCCAAGGAGCTGGATGGGG - Intergenic
948476480 2:238223984-238224006 GCCTCCCAAAGTGCTGGGTGGGG - Intergenic
948515840 2:238503479-238503501 TCCCGCCCAGGGGCTGAGTGAGG + Intergenic
948693718 2:239722335-239722357 TCCACACAAGGTGCAGCGTGTGG - Intergenic
1168854581 20:999721-999743 ACCTCCCCAGGAGCTCAGTGAGG - Intronic
1169964229 20:11197067-11197089 CCCTCCAAAGATGTTGAGTGAGG - Intergenic
1170105753 20:12753175-12753197 TGGTCACAAGGTGCTCAGTGGGG - Intergenic
1170639495 20:18138834-18138856 TATTCCCAAGGTGCTTAGTGAGG - Intronic
1170708119 20:18764300-18764322 TCTTCCCAGAGTGCTGGGTGTGG - Intergenic
1170932434 20:20781264-20781286 TCCTTGCAAGGTGCTGGGTCAGG - Intergenic
1172696213 20:36824907-36824929 GCCTCCCAAAGTGCTGTGTCTGG + Intronic
1172712140 20:36933744-36933766 GCCTCCCAAAGTGCTGAGATTGG + Intronic
1173224887 20:41156632-41156654 TCCTCTCATGGTTCTGAGTTGGG + Intronic
1173764561 20:45595731-45595753 GCCTCCCAAAGTGCTGGTTGGGG - Intergenic
1174481069 20:50831832-50831854 CCCTCCCAAGCTGCAGAGGGAGG + Intronic
1174487006 20:50867611-50867633 GCCTCCCAAGGTGCTGGGATTGG + Intronic
1175230553 20:57470962-57470984 TCCTGCAAAGGGGCTGAGTTAGG + Intergenic
1176135244 20:63519679-63519701 TCCTCGCCGGGTGCTCAGTGAGG - Intergenic
1176622506 21:9069329-9069351 TCCCCCACAGGTGCTGAGAGGGG - Intergenic
1180550855 22:16538413-16538435 GCCTCCCAAAGTGCTGGGTATGG - Intergenic
1180783123 22:18532540-18532562 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
1180953143 22:19729812-19729834 TCGTGCCAAGGTACTGACTGTGG + Intergenic
1181126685 22:20706586-20706608 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
1181159096 22:20946424-20946446 CACTCCCCAGGTGCTAAGTGCGG + Intronic
1181240021 22:21471897-21471919 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
1181353142 22:22275498-22275520 GCCTCCCAAAGTGCTGGGTATGG + Intergenic
1182622964 22:31627835-31627857 TTCTCCCATGGTGCTGTGAGGGG + Intronic
1183047423 22:35231177-35231199 TACTCCCCAGGTGTTGAGGGAGG - Intergenic
1183304309 22:37074197-37074219 TCCTGCCACGGTGCTGGGGGAGG - Intronic
1183832451 22:40425533-40425555 TCCTTCCCAGGTCCTGAGGGAGG - Intronic
1184289174 22:43489187-43489209 TCCTCCCCACATGCTGTGTGTGG - Intronic
1184787034 22:46676904-46676926 TCCTCCCAAGTCACTGAGTCAGG - Intronic
1185325073 22:50221549-50221571 GCCTCCCCAGGAGCTGAGGGGGG + Exonic
949212079 3:1515031-1515053 GCCTCCCAAAGTGCTGGGAGGGG - Intergenic
949437571 3:4046186-4046208 AGCTCCCAAGTGGCTGAGTGAGG + Intronic
949890627 3:8731326-8731348 TCCTCCCAGCGTGGTGACTGAGG + Intronic
950610907 3:14125920-14125942 TCCTACCAGGGCGCTGGGTGTGG + Intronic
953103975 3:39856975-39856997 TCCTCCCAAAGTGCTGAGATTGG - Intronic
953630976 3:44617187-44617209 TCCTACCAATGTGATGAATGTGG - Intronic
953916729 3:46925191-46925213 GCCTCCCAGGGATCTGAGTGGGG - Intronic
954372367 3:50175515-50175537 TCCACTCTGGGTGCTGAGTGAGG - Intronic
958936737 3:100263202-100263224 GTGTCCCAAGGTGCTCAGTGGGG + Intronic
960843703 3:121987024-121987046 TCCTTCCAATCTGCTCAGTGTGG + Intergenic
961895888 3:130167481-130167503 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
962226182 3:133611991-133612013 GCCTCCCAAAGTGCTGAAAGTGG + Intronic
963854366 3:150238696-150238718 CCCTACCAATGTGATGAGTGTGG + Intergenic
967194701 3:187016359-187016381 TCTTCTCCAGGTGCTGCGTGTGG - Intronic
967937993 3:194744564-194744586 GCCTCCCCAGGTTGTGAGTGAGG + Intergenic
968196296 3:196710286-196710308 ACCTCCCAAAGTGCTGGCTGGGG - Intronic
968588732 4:1447009-1447031 CCCTCGCTAGGTGCTGTGTGGGG + Intergenic
968626861 4:1629695-1629717 TCTTCCCAAGGGGCTGAGTCTGG - Intronic
969372021 4:6737992-6738014 GCCTCCCAAAGTGCTGGGAGGGG + Intergenic
969414267 4:7048402-7048424 ACCTCCCAAGCTGCTGAGTCAGG + Intronic
969935609 4:10677520-10677542 TAATCCCCAGGTGCTGAGGGAGG + Intronic
970644310 4:18102578-18102600 TCCTTCCAAGGCCCTGAGAGGGG - Intergenic
970929625 4:21494482-21494504 CCCTATTAAGGTGCTGAGTGCGG + Intronic
971312413 4:25536747-25536769 TTCTCCAAATGTGCTGTGTGTGG + Intergenic
972495264 4:39628559-39628581 GCCTCCCAAGTTGCTGACTTGGG - Intronic
974935254 4:68403765-68403787 GCCTCCCAAAGTGCTGAGGCGGG - Intergenic
975933424 4:79554165-79554187 GGGTCCCAAGGTGCTCAGTGGGG + Intergenic
976095708 4:81506438-81506460 TCATCCCAAGGTGCTGGGATGGG - Intronic
976421267 4:84847152-84847174 TGCTTCCAAAGTGCTGAGTCAGG + Intronic
976639435 4:87322373-87322395 TCCTTCCAAGCTGCTAAATGAGG - Intronic
976740233 4:88348978-88349000 GGCTCACAAGGTGCTCAGTGGGG + Intergenic
980815955 4:137946666-137946688 TCCTCCCTAGTTCCTCAGTGAGG + Intergenic
981238830 4:142450181-142450203 TCCTTGCCAGGGGCTGAGTGGGG - Intronic
983056605 4:163104087-163104109 GGGTCCCAAGGTGCTCAGTGGGG + Intergenic
985717389 5:1470297-1470319 TGCTCCCTGGGGGCTGAGTGGGG - Intronic
986041416 5:3997521-3997543 TCCTCTCAAGGTGCTGCTTGTGG - Intergenic
987060069 5:14234049-14234071 GCCTCCCAAGGTGCTGAGATAGG + Intronic
987121945 5:14776082-14776104 TCTTCCCAGGGAGCAGAGTGTGG + Intronic
987380762 5:17283775-17283797 TCCTCCCAAAGTGCTGTTAGAGG + Intergenic
987831935 5:23105597-23105619 TCCTCCCAAGGTTCTGAGGATGG + Intergenic
990856936 5:60279114-60279136 TCTTCCTAAGATGCTGAATGGGG - Intronic
990991442 5:61688312-61688334 TGCTCCCACGATGCTGGGTGGGG - Intronic
991084758 5:62638599-62638621 TACTTCCAAGGTGATGAGGGTGG + Intergenic
992590457 5:78290691-78290713 TCCTCCCAAGGTGCTGGAATTGG - Intronic
992771585 5:80053817-80053839 GCCTCCCAAAGTGCTGGGTTTGG + Intronic
992881071 5:81110932-81110954 CCCTGCCAAGGAGCTGACTGGGG - Intronic
993662622 5:90657177-90657199 TCCTCCCAAAGTGCTTAGATGGG - Intronic
994246344 5:97482742-97482764 TCCTCCCAAGTAGCTTACTGTGG - Intergenic
994645658 5:102465742-102465764 TCCAACCAAGGTGCTAACTGAGG - Intronic
995898919 5:117046619-117046641 TGGTCACAAGGTGCTCAGTGGGG + Intergenic
996026442 5:118651391-118651413 TCCTCCCAAAACGCTGAGTCTGG - Intergenic
997130158 5:131268705-131268727 GCCTCCCAAAGTGCTGAGATTGG + Intronic
998802857 5:145888354-145888376 TTCTCCCAAGGTGCTCACGGTGG + Intergenic
999141631 5:149366192-149366214 TCCACCCAAGGTGCTCAGAATGG + Intronic
999156125 5:149458705-149458727 ACCTCCCAAGGTGGTCACTGGGG + Intergenic
999157244 5:149466879-149466901 CACTCACAAAGTGCTGAGTGAGG - Intergenic
999765072 5:154733908-154733930 GCCTCCCAAAGTGCTGAGTTAGG - Intronic
1000816709 5:165931715-165931737 TGCTCCCAAGCTGATGAATGCGG + Intergenic
1001805667 5:174583789-174583811 GCTTCCCAAGGTGCTGAAAGAGG - Intergenic
1001915142 5:175553990-175554012 CCCTCCCAAAGTGCTGAGATTGG - Intergenic
1004333362 6:14741503-14741525 CCCTCCAAAGGTTCTGAGGGAGG - Intergenic
1004900026 6:20184992-20185014 GCCTCCCAAAGTGCTGATTATGG - Intronic
1005458795 6:26047776-26047798 TACTTCCAAGGTGCAGAGAGGGG - Intergenic
1005699949 6:28390614-28390636 CCCTACCAATGTGATGAGTGTGG - Exonic
1007960832 6:45957516-45957538 TCCTCCCCAGGTGCTGGGGAGGG + Intronic
1010038510 6:71354563-71354585 TCCTTCCTTGGTGCTGGGTGAGG - Intergenic
1011667743 6:89651364-89651386 GCCTCCCAAAGTGCTGATTACGG - Intronic
1011706188 6:90003683-90003705 TGATACCAAGGTGCAGAGTGTGG + Intronic
1012260285 6:97080730-97080752 TCCTCCCATGGAGCTTACTGGGG + Intronic
1012357768 6:98337350-98337372 TTCTGCCATTGTGCTGAGTGGGG + Intergenic
1012604817 6:101144847-101144869 GCCTCCCAGGGTGCAGAGTAGGG + Intergenic
1015035520 6:128649535-128649557 TTCTCTCTTGGTGCTGAGTGAGG + Intergenic
1015266370 6:131295586-131295608 GGGTCCCAAGGTGCTCAGTGGGG - Intergenic
1015267197 6:131300976-131300998 GGGTCCCAAGGTGCTCAGTGGGG - Intergenic
1016753771 6:147660988-147661010 TTCTGCCAAGGTGCTCAATGAGG + Intronic
1017140079 6:151182345-151182367 GCCTCCCAAAGTGCTGGGGGTGG - Intergenic
1018751743 6:166812479-166812501 GCCTTCCCAGGGGCTGAGTGTGG + Intronic
1018935908 6:168274038-168274060 TCCTCCCATGGTGCTGGGCTGGG - Intergenic
1019964342 7:4486373-4486395 TGCTTCCAAAGTGCTGAGAGTGG - Intergenic
1019992265 7:4700558-4700580 GCCTCCCAAAGTGCTGGGAGGGG - Intronic
1021393309 7:20120945-20120967 TGGTCACAAGGTGCTCAGTGGGG - Intergenic
1021394129 7:20126332-20126354 TGGTCACAAGGTGCTCAGTGGGG - Intergenic
1022983015 7:35622605-35622627 TCCTTCCAAAGAGCTCAGTGTGG + Intergenic
1024124019 7:46273312-46273334 TCCTTCCAAGATCCTGAGAGGGG - Intergenic
1026666456 7:72343974-72343996 TCCTGCAAAGCTGCTGAGTGAGG - Intronic
1027758013 7:82240711-82240733 TCCTCCCAAAGTGCTGAGATTGG - Intronic
1030165261 7:106548226-106548248 ACCACCCGAGGTGCTGACTGAGG - Intergenic
1030272293 7:107683525-107683547 CCATCCCAAGGGGGTGAGTGTGG + Exonic
1034262013 7:149763140-149763162 TCTTCCCAAAGAACTGAGTGTGG - Intergenic
1034897310 7:154885866-154885888 TCAGCCCAAGGTGGTGACTGTGG - Intronic
1035275527 7:157745980-157746002 TCCTCACAGGGCCCTGAGTGTGG + Intronic
1035275539 7:157746031-157746053 TCCTCACAGGGCCCTGAGTGTGG + Intronic
1035471993 7:159116228-159116250 TCCTCCCAAGGCTCTGAGGTTGG - Intronic
1036370051 8:8154877-8154899 GCCTCCCAAAGTGCTGAGATTGG + Intergenic
1036880841 8:12510753-12510775 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
1036926006 8:12906491-12906513 GCCTCTCAAAGTGCTCAGTGTGG + Intergenic
1037483698 8:19327991-19328013 TCCTGCCATGTTGCTGAGAGAGG - Intronic
1039704787 8:39995535-39995557 GCCTCCCAAAGTGCTGGGTGTGG + Intronic
1039718417 8:40135745-40135767 GCCTCCCAAAGTGCTGAGATAGG - Intergenic
1040679628 8:49792772-49792794 TGCCCCTAAGGTGCTGGGTGGGG + Intergenic
1041465175 8:58151161-58151183 CCCTCCCAGGGAGCAGAGTGAGG + Intronic
1043378368 8:79675029-79675051 TTCTGCCAAAATGCTGAGTGTGG - Intergenic
1044258944 8:90095635-90095657 TGGTCACAAGGTGCTCAGTGGGG + Intergenic
1045533320 8:103004368-103004390 GGCTCACAAGGTGCTCAGTGGGG - Intergenic
1046593112 8:116229197-116229219 GCCTCCCAAAGTGCTGAGACAGG + Intergenic
1048421159 8:134279584-134279606 CCCTTCACAGGTGCTGAGTGGGG - Intergenic
1049805418 8:144536621-144536643 TTCTCCCAGGGTCCTGGGTGAGG + Intronic
1052745110 9:32433002-32433024 TCATAGCAAGGTGCTGAGGGAGG - Intronic
1054764532 9:69032503-69032525 GCCTCCCAATATGCAGAGTGGGG + Intergenic
1056552526 9:87663737-87663759 GCCTCTGAAGGTGCTGTGTGAGG - Intronic
1056764805 9:89438102-89438124 GCCTCCCTGGGGGCTGAGTGTGG + Intronic
1056882666 9:90412923-90412945 GGGTCCCAAGGTGCTCAGTGGGG - Intergenic
1057234493 9:93347817-93347839 GGGTCCCAAGGTGCTCAGTGGGG - Intergenic
1057235305 9:93353129-93353151 GGGTCCCAAGGTGCTCAGTGGGG - Intergenic
1057785275 9:98082733-98082755 TGCTCCCAAGGTACTGCCTGGGG + Intronic
1057821308 9:98333184-98333206 TGCTCTCCAGGTGCTGGGTGTGG + Intronic
1057985238 9:99706747-99706769 GCCTCCCAAGATGAAGAGTGAGG - Intergenic
1059318148 9:113444896-113444918 GCCTCCCAATGTTCTGAGAGAGG + Exonic
1060041672 9:120305901-120305923 TCCTCCCTATGTGCAGACTGTGG + Intergenic
1060841019 9:126793203-126793225 GCCTCCCAAAGTGCTGAGATTGG - Intergenic
1061059502 9:128243482-128243504 CCCTCCCAAGGTGGAGAGTTGGG - Intronic
1062167342 9:135114565-135114587 ACCTCCCAAGGGGGTGAGTGTGG + Intronic
1062237017 9:135515190-135515212 CCTTCCCCAGGTGCAGAGTGAGG + Intergenic
1062692662 9:137851381-137851403 GCCTCCCAAAGTGCTGGGTATGG + Intronic
1203745700 Un_GL000218v1:39758-39780 TCCCCCACAGGTGCTGAGAGGGG - Intergenic
1203564412 Un_KI270744v1:79722-79744 TCCCCCGCAGGTGCTGAGAGGGG + Intergenic
1186954894 X:14670863-14670885 TCCTCCTAAGGAGCTCAGGGTGG + Intronic
1187327685 X:18307025-18307047 GCCTCCCAAAGTGCTGAATTAGG - Intronic
1189243148 X:39541156-39541178 TGTCCCCAAGGAGCTGAGTGAGG - Intergenic
1189816922 X:44833529-44833551 GCCTCCCAAATTGCTGGGTGTGG + Intergenic
1190172575 X:48123199-48123221 GCCTCCCAAAGTGCTAGGTGCGG + Intergenic
1192731928 X:73809218-73809240 TGGTCACAAGGTGCTCAGTGGGG + Intergenic
1193575302 X:83187822-83187844 TCTTCCCAAAGTGCTGAGATTGG + Intergenic
1195501161 X:105601682-105601704 AGCTCCCAAGGGGCTGAGAGGGG - Intronic
1197311438 X:124910510-124910532 TCCCCCCAAGGTGATGATTTGGG - Intronic
1198223245 X:134622226-134622248 TCCTGCCTTGGTGCTGAGCGGGG + Intronic
1198459677 X:136851102-136851124 TCCTCCCAAAGTGCTGAGACTGG + Intronic
1199807028 X:151310170-151310192 TCCCCACAATGTGCTCAGTGAGG + Intergenic
1200047201 X:153409294-153409316 TCCTCCCCAGGTTCTGAATCCGG + Intergenic
1200089651 X:153628416-153628438 ACCTCCTAAGGGGCTGGGTGAGG + Intergenic