ID: 1072328128

View in Genome Browser
Species Human (GRCh38)
Location 10:94318645-94318667
Sequence AGGAGCAGGAGGCAGTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072328122_1072328128 -4 Left 1072328122 10:94318626-94318648 CCACACTCAGCACCTTGGGAGGA 0: 1
1: 0
2: 0
3: 45
4: 325
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data
1072328114_1072328128 30 Left 1072328114 10:94318592-94318614 CCAAGCTGAAATTGTGTCCATCC 0: 1
1: 0
2: 1
3: 6
4: 122
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data
1072328116_1072328128 13 Left 1072328116 10:94318609-94318631 CCATCCTTGTGGATCACCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data
1072328120_1072328128 -3 Left 1072328120 10:94318625-94318647 CCCACACTCAGCACCTTGGGAGG 0: 1
1: 0
2: 11
3: 115
4: 757
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data
1072328117_1072328128 9 Left 1072328117 10:94318613-94318635 CCTTGTGGATCACCCACACTCAG 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1072328128 10:94318645-94318667 AGGAGCAGGAGGCAGTGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072328128 Original CRISPR AGGAGCAGGAGGCAGTGGGT AGG Intronic
No off target data available for this crispr