ID: 1072337618

View in Genome Browser
Species Human (GRCh38)
Location 10:94412928-94412950
Sequence CAGGATCTACTTGGGTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072337618_1072337626 -7 Left 1072337618 10:94412928-94412950 CCTTGAGACCCAAGTAGATCCTG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1072337626 10:94412944-94412966 GATCCTGGGTGGGGTCCACCAGG No data
1072337618_1072337631 21 Left 1072337618 10:94412928-94412950 CCTTGAGACCCAAGTAGATCCTG 0: 1
1: 0
2: 0
3: 9
4: 151
Right 1072337631 10:94412972-94412994 AACTTTTTAAAAAGACCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072337618 Original CRISPR CAGGATCTACTTGGGTCTCA AGG (reversed) Intronic
901630695 1:10646854-10646876 CAGGATCAACTCGGGGCCCATGG + Intronic
903706926 1:25292788-25292810 AGTGATCTCCTTGGGTCTCATGG - Intronic
903720312 1:25400559-25400581 AGTGATCTCCTTGGGTCTCATGG + Intronic
907575180 1:55519935-55519957 CAAGCTCTTCTTGGTTCTCATGG - Intergenic
910146501 1:84086265-84086287 CAAGTTCTACTGGGGTCCCATGG - Intronic
910867620 1:91802708-91802730 CACCATCTACTTTTGTCTCATGG + Intronic
911223049 1:95271376-95271398 CAGCATATAGTTGGGTCTTAGGG - Intergenic
912870060 1:113295520-113295542 CAAGATATACATGGTTCTCAGGG + Intergenic
914221600 1:145686835-145686857 CTGCTTCTACTTGGGTGTCAAGG - Intronic
914474165 1:148009701-148009723 CTGCTTCTACTTGGGTGTCAAGG - Intergenic
915021723 1:152786147-152786169 CAGGACCCACGTGGGTATCAGGG + Intronic
915744125 1:158143101-158143123 CAGGAACTACCTGGACCTCAGGG - Intergenic
920212576 1:204339047-204339069 CAGTTTCCACTTGGGTCTCCTGG + Intronic
922733643 1:227968043-227968065 CAGGCTCAACTTTTGTCTCATGG + Intergenic
1063481667 10:6381796-6381818 CAGCATCTACTTGGGTAACATGG - Intergenic
1065519475 10:26557612-26557634 CAGGTTCTAGTGGGGTCACAGGG + Intronic
1066167836 10:32807774-32807796 CTGCATCTGCTTGGTTCTCACGG - Intronic
1068809879 10:61243518-61243540 CAGGATCCATTTGGTTTTCACGG + Intergenic
1072337618 10:94412928-94412950 CAGGATCTACTTGGGTCTCAAGG - Intronic
1074649330 10:115501324-115501346 CAGGATAAACTTGGGGCTCATGG + Intronic
1075497753 10:122941651-122941673 CAGGATGTACCTGGTTCTCTAGG - Intronic
1075562282 10:123476880-123476902 CAGGATCCAGATGGGTCCCAGGG + Intergenic
1077854681 11:6111716-6111738 CAGCATCCACTTGTGTCTCCTGG + Intergenic
1080577489 11:33613484-33613506 CAGCATCTTCTTAGGCCTCAAGG + Intronic
1082951982 11:58827123-58827145 CAAGATATACTTGGGGCTCCTGG - Intergenic
1088820947 11:113457075-113457097 CCGGAGCTGCTTGGGTCTCCTGG - Intronic
1090786197 11:130049574-130049596 GTGGATCTACTTCTGTCTCATGG - Intergenic
1091564021 12:1634679-1634701 CAGGAGCTACTCTGGGCTCAGGG - Intronic
1092947107 12:13466717-13466739 CAGGATTTACATGGGTTTGAGGG + Intergenic
1097080686 12:56428633-56428655 CAGGATGCACTTGGCTCTGAAGG - Exonic
1097725073 12:63066109-63066131 CAGGTTCCACCTGGGTCTCTTGG + Intergenic
1098639789 12:72825032-72825054 GAGAATCAACTTGGGTCTGAAGG - Intergenic
1101797207 12:107986145-107986167 CAGGATTCACTTGGGACTTAGGG + Intergenic
1103728448 12:123010752-123010774 CTGGGTCCACTTGGCTCTCAGGG - Intronic
1104514307 12:129410120-129410142 CAGGATCCACATGGAACTCATGG - Intronic
1106733239 13:32563489-32563511 CAGGATCTGCTGGGGACCCAGGG - Intergenic
1111852688 13:93596965-93596987 TAAGTTCTTCTTGGGTCTCAAGG - Intronic
1111953115 13:94726409-94726431 CAGCTTCTACCTGGGTCTCTTGG + Intergenic
1112187299 13:97139737-97139759 CAGAATCTCCTTGTGTGTCATGG + Intergenic
1113972865 13:114203584-114203606 CAGGATTTTCTTGGGTGACAAGG + Intergenic
1114821617 14:26027065-26027087 CAGAACCTACTTGGGCCTCATGG - Intergenic
1116137210 14:40941844-40941866 CATCATCAACTTGGGTCTGAAGG + Intergenic
1117429286 14:55637039-55637061 CAGGCTATACTTGCGTTTCATGG - Intronic
1119567404 14:75640549-75640571 CAGGATCTCCGTGGCTCTCTGGG - Intronic
1119867903 14:77989525-77989547 CAGGAGCTATTTGGGGCTAAGGG - Intergenic
1120217716 14:81697992-81698014 CAAGATCTTCTTATGTCTCAAGG + Intergenic
1121438542 14:93934498-93934520 CAGGATCTCACTGGGTCTCAGGG - Exonic
1121439968 14:93942373-93942395 CTGGATCTGCTCCGGTCTCAGGG - Intronic
1122720612 14:103720066-103720088 CAAAATCTACTTGCATCTCAGGG - Intronic
1126061360 15:44785681-44785703 CAGGACCTTCTTGTGTCTGATGG - Intergenic
1128579817 15:68801507-68801529 CATGATCTCATTGGGTCCCATGG - Intronic
1133132071 16:3682832-3682854 CAGGATCTTCTTCCGTCTCCAGG - Intronic
1133166447 16:3950921-3950943 AGGGATCCTCTTGGGTCTCAGGG + Intergenic
1138301603 16:55934892-55934914 CGGGTTCTTCTTGGGTCTCTAGG - Intronic
1141092053 16:81137180-81137202 CAGGTCATACTTGGGTGTCATGG + Intergenic
1143418498 17:6769778-6769800 TAGGATTTACTTTGGCCTCATGG - Intronic
1147143782 17:38473877-38473899 CAGGCTCTTCCTGGGTATCAAGG - Intronic
1147516038 17:41118330-41118352 AAGGATCTAGTTGGGTTTCTAGG + Exonic
1147581904 17:41631809-41631831 CAGGGTCTACTAGGGTGTCCTGG - Intergenic
1147891972 17:43723685-43723707 CAGGGTCTCCTTCTGTCTCAGGG - Intergenic
1147983860 17:44292923-44292945 CAGTATCTACTTGGAACTAATGG - Intergenic
1148036596 17:44667814-44667836 CAAGATCTACTGGAGTCACAGGG + Exonic
1148616474 17:49004200-49004222 TGGGATCTCCTGGGGTCTCAGGG - Intronic
1149619405 17:58031514-58031536 CAAGATCAACTTGGGTAACATGG - Intergenic
1151574610 17:74946311-74946333 CAAGATCGACTTGGGTAACATGG - Intronic
1154958496 18:21283833-21283855 CAGGATCAACTTGGTTCCTAAGG + Intronic
1156903665 18:42329882-42329904 CAGAATCAAGTTGGGTCTCAGGG + Intergenic
1157668699 18:49510540-49510562 GAGGATGAACTTGGGGCTCAGGG + Intergenic
1159632535 18:70765499-70765521 TAGGAGCTACATGGGTCCCAGGG + Intergenic
1160100461 18:75916020-75916042 CTGGATCTCCTGGGGTCTCCAGG - Intergenic
1163625397 19:18386600-18386622 CTGGATCCCCTTGGGTCTGATGG + Intronic
1166001008 19:39877448-39877470 CAGTTTCTGCTTGGGTCTCCTGG - Intronic
1166003791 19:39893707-39893729 CAGTTTCTGCTTGGGTCTCCTGG - Intronic
925902430 2:8518124-8518146 CAGCAACTTCCTGGGTCTCAGGG + Intergenic
927906492 2:26862445-26862467 AATGATCTACTTGGGTCTATAGG + Intronic
930632871 2:53772879-53772901 CAGGTTCTACTGGGGTCTACGGG - Intronic
931666098 2:64610471-64610493 CAGCAGACACTTGGGTCTCAGGG - Intergenic
935336346 2:102020837-102020859 CAGGATCTCAGTGGCTCTCAAGG + Intronic
935791112 2:106591123-106591145 CAGCATCTACTTGGGTTTTGGGG + Intergenic
937603238 2:123765881-123765903 CAGCATATAATTGGGTTTCAGGG + Intergenic
938304798 2:130245845-130245867 CAGGATCTTCTTTGGGCACATGG + Intergenic
938806775 2:134813484-134813506 CAGGTTCTATGTGGGTCTCTTGG - Intergenic
939823375 2:146984101-146984123 TAGGATCCACTTGGGCCTCAGGG - Intergenic
941058164 2:160812362-160812384 CACCTTCTACTTGGGTCTCCTGG + Intergenic
942239011 2:173941666-173941688 CAGAATATACTTGGCTTTCATGG + Intronic
947639900 2:231701448-231701470 CAGGGCCTACTTGGGCCTCCTGG + Intergenic
1174474970 20:50790194-50790216 CAGGACCTACTTGCCTCACAGGG + Intergenic
1175607241 20:60321120-60321142 CAGGAGCTCCTGGGGTCGCAGGG - Intergenic
1180073870 21:45451910-45451932 CAGGAACCACTTGGCTCTGATGG - Intronic
1180975985 22:19848739-19848761 CAGGAGCTGCCTGGGTCCCAAGG + Exonic
1181005366 22:20010963-20010985 CAGGATCTATGTTGGCCTCAGGG - Intronic
1181349051 22:22242444-22242466 CAAGGTCTACAAGGGTCTCAGGG - Intergenic
1183848292 22:40561899-40561921 CAGCTTCTACTTTGGTCTCTTGG + Intronic
1184520549 22:44991513-44991535 CAGCCTCTCCTTGGGTCTCCTGG - Intronic
950330045 3:12149069-12149091 CAGGCTCTCGTTGGGTCTCAGGG - Intronic
952383072 3:32819070-32819092 CATGATCTACTTTGGTAGCAAGG - Intronic
953882803 3:46700392-46700414 CAGGGTCTCCCTGGTTCTCAGGG + Intergenic
957129023 3:76199469-76199491 GAGGTTCTATATGGGTCTCAAGG - Intronic
962474422 3:135742692-135742714 CAGGTTCTATGTGGGCCTCAAGG - Intergenic
963179503 3:142338987-142339009 CAGGATCTACCTGGGACCTAAGG + Intronic
963878852 3:150504996-150505018 CAGTAGCAACTTGGGTCCCAGGG - Intergenic
965702132 3:171468673-171468695 CAGCTTCTACCTGGTTCTCATGG - Intergenic
965812059 3:172601439-172601461 CTAGATCTAGTTGTGTCTCAGGG - Intergenic
966685253 3:182686486-182686508 CAGGATCTACTTGTTTTTGAGGG - Intergenic
967281658 3:187829154-187829176 CAGGATGGACTTTGTTCTCAGGG + Intergenic
969353675 4:6612881-6612903 CAGGGTGTAATTGGGCCTCAGGG + Intronic
972688408 4:41373144-41373166 CGGGATCTCCTTTGGTCTAAGGG + Intronic
973580401 4:52338955-52338977 CAGGAACAACTGGGGCCTCAGGG + Intergenic
973725786 4:53774235-53774257 AAGGATCTACTTGGTTTCCATGG + Intronic
973880670 4:55268620-55268642 CAGTTTCTGCTTGGGTTTCATGG - Intergenic
977220104 4:94327943-94327965 ATGCAGCTACTTGGGTCTCAGGG + Intronic
982208707 4:153017950-153017972 CAGGATCTAGCTTGGTCCCATGG + Intergenic
982666301 4:158268820-158268842 CAGGATCTCTTTGGCTCTGATGG - Intergenic
984364697 4:178783686-178783708 CAGGATCCTCCTGGTTCTCAAGG + Intergenic
985334119 4:188873143-188873165 CAGGAGATACTTGGAGCTCAGGG - Intergenic
985769125 5:1797972-1797994 TAGCATCTGCTTGGGTCTCTCGG + Intergenic
986559657 5:9047905-9047927 CAGGTTCTCCTGGGTTCTCAAGG + Intronic
988163266 5:27548957-27548979 CAGGATCTACTTGAGTGTGAAGG + Intergenic
994747575 5:103697725-103697747 GAGGCTCTACTAGGTTCTCACGG + Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
1000164251 5:158632109-158632131 CAGGTGCTACTTAGGTCTGATGG + Intergenic
1003355166 6:5362403-5362425 CAGGATTTACTTCTGTCTAAAGG + Intronic
1006335623 6:33419025-33419047 CAGGATGTGCTTGGGCCCCAGGG - Intergenic
1006683763 6:35815349-35815371 GAGGATGTGCTTGGGCCTCAAGG - Intronic
1007142634 6:39591179-39591201 CAGGATCTACCTGGGGCGCTGGG + Intronic
1010080123 6:71851924-71851946 CAGGGCCTACTTGAGTCTGAAGG - Intergenic
1011520342 6:88197492-88197514 CAGGATGGACTTGGGTCACAAGG + Intergenic
1013349080 6:109290065-109290087 CAGGATCTACGTGTGGCACAGGG - Intergenic
1019411463 7:908579-908601 CAGGCCTTACTTGGGTCTGAGGG - Intronic
1019820096 7:3236214-3236236 CAGCTTCTGCTTGGGTCTCTTGG + Intergenic
1019955545 7:4411459-4411481 CAGCTTCTCCTTGAGTCTCAGGG - Intergenic
1021147823 7:17110761-17110783 CAAGATAAACTTGGGTCTCCTGG - Intergenic
1021424694 7:20486700-20486722 CTGCAGCTGCTTGGGTCTCAGGG - Intergenic
1022221261 7:28316041-28316063 CTGGAACAACTTGGGTCTCCAGG - Intronic
1022236319 7:28465165-28465187 CAGTACCTACTAGAGTCTCATGG - Intronic
1022523431 7:31022470-31022492 CAGCATCTACCTGGGACTGATGG - Intergenic
1026426927 7:70304013-70304035 CATCACCTTCTTGGGTCTCAGGG + Intronic
1029756592 7:102577900-102577922 TTGGATCTCCTTGGGTTTCAAGG - Intronic
1029774534 7:102676969-102676991 TTGGATCTCCTTGGGTTTCAAGG - Intergenic
1031804841 7:126295038-126295060 CAGGATATACATTGTTCTCAAGG + Intergenic
1033471284 7:141651782-141651804 CAGAATCTCCTTGGGAGTCATGG + Intronic
1033602118 7:142896047-142896069 CAGGATCTACTCTAGTCTCCTGG - Intergenic
1033682186 7:143605278-143605300 CAAGAGCTATCTGGGTCTCACGG - Intergenic
1033702703 7:143856635-143856657 CAAGAGCTATCTGGGTCTCACGG + Intronic
1035394292 7:158525319-158525341 CAGCTTCTGCTCGGGTCTCACGG - Intronic
1037063945 8:14552662-14552684 CAGGATCCTCATGGGCCTCAGGG - Intronic
1040706203 8:50131494-50131516 CAGGATTTACTTGTGTATTAAGG + Intronic
1043533603 8:81176293-81176315 ATGGATCTACTGGGGTCTGAAGG + Intergenic
1053234948 9:36444982-36445004 CAGGATTTGTTTGGGTCTGAGGG - Intronic
1056461961 9:86817305-86817327 CAGGGTCTCCTTGGGCCTCTGGG - Intergenic
1059383996 9:113950007-113950029 CAGGATCTACGGGGGTTTAATGG - Intronic
1060228225 9:121809024-121809046 CAGGATCTCCCAGGGGCTCAGGG - Intergenic
1060910682 9:127347498-127347520 CAGGATCCACAGAGGTCTCAAGG - Intronic
1062357298 9:136170905-136170927 CAGGATCTGCAGGGGTCCCAGGG - Intergenic
1186053851 X:5628052-5628074 CAGGATCTCCTGAGGTATCACGG + Intergenic
1186296593 X:8155466-8155488 CAGCAACTACTGGGGTCTCCAGG - Intergenic
1189888889 X:45577876-45577898 CTGCAGCTGCTTGGGTCTCAGGG + Intergenic
1190496337 X:51031504-51031526 CTGTATCTCCTAGGGTCTCAGGG - Intergenic
1196206998 X:112951860-112951882 CACGATCTATTTGGTTTTCAGGG + Intergenic
1198587390 X:138137612-138137634 CAGGATGTAGAAGGGTCTCAGGG - Intergenic
1201395336 Y:13541511-13541533 CAGCATATCATTGGGTCTCAGGG - Intergenic