ID: 1072346247

View in Genome Browser
Species Human (GRCh38)
Location 10:94509654-94509676
Sequence GTATCTGCCAGGTCTAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072346247_1072346251 -5 Left 1072346247 10:94509654-94509676 CCATACCTAGACCTGGCAGATAC 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1072346251 10:94509672-94509694 GATACCCCTAGGAAGAAAAATGG 0: 1
1: 0
2: 0
3: 17
4: 218
1072346247_1072346256 18 Left 1072346247 10:94509654-94509676 CCATACCTAGACCTGGCAGATAC 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1072346256 10:94509695-94509717 ACACTGGTGTCTACTCACCAAGG 0: 1
1: 0
2: 0
3: 19
4: 169
1072346247_1072346255 2 Left 1072346247 10:94509654-94509676 CCATACCTAGACCTGGCAGATAC 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1072346255 10:94509679-94509701 CTAGGAAGAAAAATGGACACTGG 0: 1
1: 0
2: 1
3: 33
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072346247 Original CRISPR GTATCTGCCAGGTCTAGGTA TGG (reversed) Intronic
900714870 1:4137865-4137887 GCATCTGCCAGGTCTGGGGAGGG + Intergenic
918633152 1:186743553-186743575 GCATCTGACAGGGCTAGGCAGGG + Intergenic
919297505 1:195721429-195721451 GTATCTGCCTTATCTGGGTATGG - Intergenic
922151899 1:223013601-223013623 GTGTGTGCCACGTCTATGTATGG + Intergenic
1065652081 10:27902965-27902987 GTCTCTGCCAGGTTTTGGTATGG - Intronic
1067190571 10:44064513-44064535 GTATCTGCCAGGAGCAGGGAGGG - Intergenic
1068815050 10:61300200-61300222 GTATCTCCCAGAGCTGGGTATGG - Intergenic
1071987022 10:91062026-91062048 GTATGTGCCAGGTCCGGGTTAGG - Intergenic
1072346247 10:94509654-94509676 GTATCTGCCAGGTCTAGGTATGG - Intronic
1072723154 10:97793254-97793276 GTGTCAGCCAGGTCCAGGCACGG + Intergenic
1076732388 10:132445192-132445214 GGATCTGCCAGGACTGGGAAGGG + Exonic
1080420986 11:32110266-32110288 TTATCTGCCATTTCTAAGTAGGG - Intergenic
1081970914 11:47198123-47198145 GTCTCTTCCTGGTTTAGGTAAGG + Intergenic
1084166421 11:67376765-67376787 GTCTCTGCCAGGTCCTGTTAAGG + Intronic
1086542906 11:87933962-87933984 GTTTCTACCACGTCTGGGTAGGG + Intergenic
1086542916 11:87934005-87934027 GTTTCTACCATGTCTGGGTAGGG + Intergenic
1090204410 11:124876624-124876646 GGAGCTGCCAGGACTAGGGAGGG + Intronic
1090229086 11:125088946-125088968 CTATATGCCAGCTCTAGGAATGG + Exonic
1090352126 11:126114465-126114487 GTAACTGCCAAGTGTAGGGAGGG + Intergenic
1092269559 12:7012457-7012479 GTAACTGGCAGGTTTAGGTGGGG + Intronic
1095431865 12:42143549-42143571 GCATTTGCCAAGTCTTGGTAGGG + Intronic
1096840014 12:54374406-54374428 GTCTCTACCAGGACTAGGTGGGG - Intronic
1097286578 12:57881895-57881917 GTAAATGCCAGTTATAGGTATGG + Intergenic
1100085072 12:90900791-90900813 GGATCTTACAGGTCTTGGTAAGG + Intergenic
1103010338 12:117453774-117453796 TTCTCTGCCTGGTCCAGGTATGG + Exonic
1110338757 13:74364418-74364440 GTGTCTTCCAGGTATAGGAAGGG - Intergenic
1113614983 13:111673910-111673932 GTAGATGCCAGCTCTAAGTAGGG - Intergenic
1113620453 13:111758824-111758846 GTAGATGCCAGCTCTAAGTAGGG - Intergenic
1113754531 13:112801729-112801751 ATATGTACAAGGTCTAGGTAAGG + Intronic
1130810626 15:87374331-87374353 GTATCTGTCAGGTTTTGGTATGG - Intergenic
1132003408 15:98203084-98203106 GTATCTTCCTTGTGTAGGTACGG - Intergenic
1134008787 16:10835784-10835806 ATATGTGCCAGGCCTGGGTAGGG - Intergenic
1144595557 17:16567544-16567566 GGACCAGCCAGGTCTGGGTATGG + Exonic
1147740431 17:42668203-42668225 GTGTCTGGCAGGTCTTGGCATGG + Exonic
1149250934 17:54768419-54768441 GAATCAGGCAGGTCTAGGTTTGG + Intergenic
1154490127 18:14915430-14915452 GTCTCTACCTGGTCTAGGTTGGG - Intergenic
1158657541 18:59352719-59352741 GTAACTGCCAGGTGGAGGTGGGG - Intronic
1163594322 19:18211983-18212005 GGAGGTGCCAGGTCTAGGTGTGG - Intronic
1166100681 19:40569828-40569850 GTCTCTGCAGGGTCCAGGTAGGG - Intronic
1167758947 19:51431409-51431431 GAATTTGCCAATTCTAGGTAAGG + Intergenic
1167820414 19:51922572-51922594 TTACCTGCCAGGTATAGGGAAGG - Intronic
925584768 2:5453572-5453594 ATAATTGCCAGGTCTAGGAAAGG - Intergenic
932284276 2:70519185-70519207 GGACCTGCCAGGTCTAAGAATGG - Intronic
932449175 2:71798765-71798787 GTATGTGCCAGGACTTGGCAGGG - Intergenic
937260404 2:120582248-120582270 TTATGTGCCAGGTCTAGGCATGG + Intergenic
937295993 2:120810236-120810258 GTATCTACCAGATCTTGGTAGGG + Intronic
941589380 2:167400565-167400587 GTATCTTCAGGGTCTAGGCATGG - Intergenic
1168891704 20:1299306-1299328 GTGACTGGCAGGTCTAGGGAGGG - Intronic
1169052479 20:2592651-2592673 CTGTCTGCCAGGTCTCTGTAAGG + Intronic
1170827198 20:19806942-19806964 GGATCTGGCAGATCTAGGTTGGG + Intergenic
1179291136 21:40019378-40019400 TTATCTGACAGGTCTAGATCTGG + Intronic
1181077511 22:20391502-20391524 GTATCTTACAGGTGTAGGTGTGG - Intergenic
1184176629 22:42792803-42792825 GTCCCTGCCAGGTCTAGGTCAGG + Intergenic
949763490 3:7499274-7499296 GTATCTCCCAAGGCTAGGTTAGG - Intronic
953377433 3:42440544-42440566 TTATCTGGCAGCTCTAGGCATGG - Intergenic
954646379 3:52134100-52134122 TTAGCTCACAGGTCTAGGTAGGG - Intronic
956435024 3:69226440-69226462 GTATCTGACAGTTTTAGGTTTGG - Intronic
956721383 3:72120908-72120930 GGATCTGACAGGTCTGGGTCAGG - Intergenic
967096762 3:186183580-186183602 GAATCTGAAAGGTCTAGGAAAGG + Intronic
969078673 4:4601328-4601350 GCATCTGGCAGATCAAGGTAGGG + Intergenic
969920625 4:10536250-10536272 GTCTCTGCCAGCTGTTGGTAAGG - Intronic
977798121 4:101192828-101192850 GAATATCCAAGGTCTAGGTAAGG - Intronic
980711504 4:136574221-136574243 GTATTTGCCAGGTCTATTTAAGG + Intergenic
985160191 4:187036025-187036047 GTATCTGCAAGGCCTGTGTAAGG + Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
997865642 5:137460377-137460399 GACTCTTCCAGGTCAAGGTACGG + Intronic
1015063605 6:128998056-128998078 GGATATGCCAGGTCAAGGAAAGG + Intronic
1015110059 6:129582528-129582550 GTATCTACTAAGTCAAGGTAGGG + Intronic
1020698521 7:11447326-11447348 GGATCTGGCAGGCCTGGGTAAGG + Exonic
1030682304 7:112446835-112446857 GTATGTGCCAAACCTAGGTAAGG + Intronic
1032843069 7:135729109-135729131 GCATCTCCCAGATCAAGGTAAGG - Intronic
1037657585 8:20898721-20898743 TCATCTGCCAAGTCTGGGTATGG + Intergenic
1037834313 8:22207211-22207233 GTATCTGTGAGGCCTAGGTTTGG + Intronic
1038564752 8:28610435-28610457 GTATTTGCCAGGACTAGGTCAGG - Intronic
1041265012 8:56055927-56055949 GTCTCTGGCAGCTCTAGGTGGGG + Intergenic
1041524475 8:58789900-58789922 TCATCTGCCAGGTCTAGGTGTGG + Intergenic
1044547749 8:93478302-93478324 GTATCTTGCAGGTCAATGTAAGG + Intergenic
1045735013 8:105284887-105284909 ATATCTGTGAGGTCTAGGCACGG + Intronic
1045807147 8:106176303-106176325 GTATTTACCAGGTCTAGGATTGG - Intergenic
1048491710 8:134900439-134900461 GTAGCTGCCAGGTCCAAGGACGG + Intergenic
1048799038 8:138179395-138179417 GTATCTGGCAGGATTAGATAGGG - Intronic
1049263407 8:141652132-141652154 CTATCTGCCAGGCCTGGGCAAGG - Intergenic
1051240736 9:15053102-15053124 GTCTCTGCCAGGTTTTGGTTTGG - Intergenic
1052242999 9:26297311-26297333 GTATCTTCCTGGTCTAGACATGG + Intergenic
1053489017 9:38486155-38486177 GTATCTGGAAGGTCCAGGAAGGG + Intergenic
1057727683 9:97579776-97579798 GACTCTGCCAGGTGTAGGGAGGG + Intronic
1058986393 9:110212077-110212099 GTATCTCCCAGGCCTAGAGATGG - Intergenic
1059027349 9:110649383-110649405 GTACCTGCCAGGACTACCTACGG - Intergenic
1059283389 9:113152975-113152997 ATCTCTGCCAGGTAGAGGTAGGG - Intronic
1060959697 9:127671320-127671342 GCATCTGCCTAGTCTGGGTAGGG - Intronic
1191017268 X:55822486-55822508 GTCTCTTCCAGGTTTTGGTATGG + Intergenic
1195630359 X:107049430-107049452 GCATCTGCCAAGTCTGGGTATGG - Intergenic
1197136088 X:123061150-123061172 TGAGCTTCCAGGTCTAGGTAAGG - Intergenic
1197784160 X:130184274-130184296 GTATCTTCCAGGTTCAGGTGTGG + Exonic
1199995971 X:153027036-153027058 GTCTCTGCCATGTCTAGGACTGG - Intergenic
1202116397 Y:21472348-21472370 GTAGATGCCAGGTCTAGTTTCGG + Intergenic