ID: 1072348581

View in Genome Browser
Species Human (GRCh38)
Location 10:94534543-94534565
Sequence GGAAATCATGCATTTCTTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072348581_1072348583 -9 Left 1072348581 10:94534543-94534565 CCGCCAAGAAATGCATGATTTCC 0: 1
1: 0
2: 0
3: 20
4: 368
Right 1072348583 10:94534557-94534579 ATGATTTCCCTGCCAACTCTAGG 0: 1
1: 0
2: 1
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072348581 Original CRISPR GGAAATCATGCATTTCTTGG CGG (reversed) Exonic
900538619 1:3191582-3191604 GGAAATCCTGCCTTTCTTCAAGG - Intronic
900910024 1:5589562-5589584 GGAATTTATTCATTTCTTTGAGG - Intergenic
902350146 1:15848076-15848098 GGAAACCAGGCATCTCTGGGTGG + Exonic
902970682 1:20045985-20046007 GGAAATCTTGCTTTCCTTGTTGG - Intronic
905803104 1:40858359-40858381 GGAAATTATACTTTTCTTGAAGG + Intergenic
905921666 1:41723368-41723390 GAAAGTCATGGAATTCTTGGGGG + Intronic
907723607 1:56997977-56997999 GGCAATCATGAATTTCTTGTGGG + Exonic
908144614 1:61226599-61226621 TGAAATAAAGCATTTCTTTGTGG - Intronic
908708478 1:66989054-66989076 GAAAATCATGCATTTCATGTTGG - Intergenic
909171954 1:72307543-72307565 GGAAATTATCCATTTCTTCTAGG + Intergenic
909672705 1:78206825-78206847 GGAATTCATCCATTTCTTCTAGG - Intergenic
909673747 1:78215688-78215710 GTAAATCAGGCATTTCTTCTTGG - Intergenic
910489867 1:87756896-87756918 GGAAACTATGCATTTGTGGGGGG + Intergenic
912591031 1:110820488-110820510 GGAATTCATCCATTTCTTCTGGG + Intergenic
912875253 1:113351287-113351309 GAAAATCATGCACATCTTGTTGG + Intergenic
913146709 1:115998534-115998556 GGAATTTATGCATTTCTTCTAGG + Intronic
913288133 1:117246405-117246427 GAGAATCAGGCAGTTCTTGGTGG - Intergenic
914455443 1:147832649-147832671 GGAAATCAGGGATTTCTTCTTGG + Intergenic
915186657 1:154111532-154111554 GGAATTTATCCATTTCTTGTAGG - Intronic
915846534 1:159271928-159271950 GGAATTTATGCATTTCTTCTAGG - Intergenic
917011585 1:170480427-170480449 GGAATTCATCCATTTCTTCTAGG + Intergenic
917418908 1:174841765-174841787 GAAAATCATCCATTTCTTCTAGG - Intronic
918515894 1:185362679-185362701 GGAATTTATCCATTTCTTGTAGG - Intergenic
918749640 1:188257033-188257055 GGAATTTATCCATTTCTTCGAGG + Intergenic
919110078 1:193207525-193207547 GGAAGGAATGCATTTCTGGGGGG - Intronic
921751662 1:218801182-218801204 GGAATTCATTCATTTCTTCTAGG + Intergenic
922231806 1:223693740-223693762 GGAAATTAAGCATTTCTTCAAGG - Intergenic
922847400 1:228698102-228698124 ACAGATCATGCATTTCTTTGAGG + Intergenic
1063543640 10:6959364-6959386 AGAAATCATGTATTTCTGGAAGG + Intergenic
1063791514 10:9454012-9454034 GGAACTAATGCATTCCTAGGGGG + Intergenic
1063982177 10:11463081-11463103 GGATATCGTGCATGACTTGGAGG + Exonic
1064236275 10:13579182-13579204 AGAAATCATCCATTTCTTCTAGG + Intergenic
1065002702 10:21351603-21351625 GGAAGGAATGCATTTCTGGGGGG + Intergenic
1065605079 10:27410063-27410085 GGAATTCATGCATTTCATCTAGG - Intronic
1065674574 10:28160660-28160682 GGAAATCTAACATTTCTTTGTGG + Intronic
1065836693 10:29664820-29664842 GGAAATCATGGTGTTCTTTGAGG - Intronic
1069611871 10:69778710-69778732 GGAAAATATGCCCTTCTTGGGGG - Intergenic
1070252319 10:74783770-74783792 GGAAATCTTGCCTTTCTTGTTGG + Intergenic
1071057590 10:81529336-81529358 GGAAATTACACACTTCTTGGCGG + Intergenic
1071689133 10:87796924-87796946 GGAAATCTTGCTTTCCTTGTTGG - Intronic
1071897195 10:90080467-90080489 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
1072348581 10:94534543-94534565 GGAAATCATGCATTTCTTGGCGG - Exonic
1072567805 10:96631976-96631998 AGAAATGATGCCCTTCTTGGTGG - Intronic
1075476591 10:122740585-122740607 GGAAATGTTTCATTTTTTGGAGG + Intergenic
1079692929 11:23442239-23442261 GGCAATCCTGCATTTCTAGTAGG - Intergenic
1080439978 11:32284003-32284025 GGAATTTATCCATTTCTTGTGGG - Intergenic
1081779797 11:45702350-45702372 GGAAATCAGGCATTATTAGGAGG + Intergenic
1083060908 11:59870345-59870367 GGAATTTATGCATTTCTTCTAGG + Intergenic
1085423461 11:76382831-76382853 GGGAAGCATGCTTTTCTGGGAGG + Intronic
1085573142 11:77577090-77577112 GGAAAACTTGCCTTTCTTGTTGG - Intronic
1086253188 11:84842346-84842368 GCACATCATGCATTAATTGGTGG - Intronic
1087079841 11:94159499-94159521 GGAATTTATCCATTTCTTCGAGG + Intronic
1087460693 11:98442233-98442255 GGAATTCATTCATTTCTTATAGG + Intergenic
1087531184 11:99384274-99384296 GTAAATAATGCATCCCTTGGTGG + Intronic
1087534961 11:99431508-99431530 GGAGATCAGGAATTCCTTGGAGG + Intronic
1088199620 11:107317580-107317602 GGAATTCATCCATTTCTTCTAGG + Intergenic
1088932593 11:114366922-114366944 GTAAGTCATGCATTTGTTGTAGG - Intergenic
1090999938 11:131901950-131901972 GGAAATCATTTCTTTCTGGGAGG + Intronic
1091317620 11:134625623-134625645 AGCAATCAAGCATGTCTTGGAGG + Intergenic
1091432618 12:449437-449459 GGAGATGATGCCCTTCTTGGGGG + Intergenic
1091821033 12:3475301-3475323 AGAAATCGTGCATTTCCTGTGGG - Intronic
1092680674 12:10976811-10976833 GGAATTTATGCATTTCTTCTAGG - Intronic
1093477307 12:19570194-19570216 GGAACTCATCCATTTCTTCTAGG + Intronic
1094034508 12:26053216-26053238 TGAAATGATGGGTTTCTTGGTGG + Intronic
1094309377 12:29061728-29061750 GGAACTCATTCATTGCTTGTGGG - Intergenic
1095530325 12:43179592-43179614 GAAAATCATGGTTATCTTGGCGG + Intergenic
1095585856 12:43848406-43848428 GAAAAGAATGCATTTCTGGGGGG - Intronic
1095940442 12:47723576-47723598 AGAAATTGAGCATTTCTTGGGGG - Intronic
1096160371 12:49371706-49371728 GGAAAGCAGGCATGTCTAGGTGG + Intronic
1098150101 12:67537827-67537849 GGAATTGATGCATTCCTTAGAGG + Intergenic
1100037418 12:90269702-90269724 TGATGTCATGCATCTCTTGGGGG + Intergenic
1100352538 12:93798200-93798222 GGAAATGATACCTTTCTTGAAGG + Intronic
1102883620 12:116505528-116505550 TGGAATCAGACATTTCTTGGTGG - Intergenic
1105768723 13:23586971-23586993 GTCTAGCATGCATTTCTTGGAGG - Intronic
1106967160 13:35084978-35085000 GGAATTCATCCATTTCTTCTAGG - Intronic
1107691642 13:42959327-42959349 CTACATCATGCATTTCTTTGTGG - Intronic
1108493950 13:51006309-51006331 GGAATTCATTCCCTTCTTGGAGG + Intergenic
1111015198 13:82371301-82371323 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
1111625808 13:90785132-90785154 GGAATTCATCCATTTCTTCTAGG + Intergenic
1112136899 13:96589290-96589312 GGAAATTATGCATTTCTTTTAGG + Intronic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114065757 14:19058895-19058917 GAAAATCAAGCATTTCTAAGAGG - Intergenic
1114096504 14:19341105-19341127 GAAAATCAAGCATTTCTAAGAGG + Intergenic
1115061037 14:29190482-29190504 GGAAATTTTGAATGTCTTGGTGG + Intergenic
1115243521 14:31272277-31272299 AGAAATCTTGCATTCCTTGTTGG - Intergenic
1116231480 14:42223564-42223586 GGAAAAACTGCAGTTCTTGGGGG + Intergenic
1116549264 14:46213681-46213703 GGAATTCATCCATTTCTTCTAGG + Intergenic
1116596055 14:46846747-46846769 GCAATTCATGCATTTAGTGGTGG + Intronic
1117947684 14:61046831-61046853 GGAAATAATGCTTTTCCTGATGG - Intronic
1118068677 14:62221016-62221038 GGAATTTATCCATTTCTTGTAGG + Intergenic
1118646255 14:67843601-67843623 GGAATTTATGCATTTCTTCTAGG + Intronic
1118652000 14:67906639-67906661 GGAAATTATCCATTTCTTCTAGG + Intronic
1118741683 14:68744106-68744128 GTAAATGATACTTTTCTTGGAGG - Intergenic
1119632558 14:76246219-76246241 GGAAATTATATATTTCTTAGTGG - Intronic
1120201033 14:81538429-81538451 GGAAAGAATGCATTCCTGGGAGG - Intergenic
1121049196 14:90809187-90809209 GGAAATCGTTCATATCTTTGAGG - Intronic
1125239842 15:37561491-37561513 GGAATTTATCCATTTCTTGTAGG - Intergenic
1126502732 15:49364358-49364380 GGAATTTATCCATTTCTTGTAGG + Intronic
1126526275 15:49658185-49658207 GGAATTTATCCATTTCTTGTAGG + Intergenic
1127565950 15:60188407-60188429 GGAAATCATCATTCTCTTGGAGG + Intergenic
1131883183 15:96880555-96880577 TGTAATCATGCATTATTTGGGGG + Intergenic
1133499441 16:6351878-6351900 GAAAATAATGCATATCTTGTAGG - Intronic
1133528248 16:6627356-6627378 GCAAAACATGCACTGCTTGGAGG + Intronic
1134221143 16:12355177-12355199 GGCTATCATTCATATCTTGGCGG + Intronic
1134343141 16:13363739-13363761 GATAAGCATGCATTGCTTGGTGG + Intergenic
1135426368 16:22340152-22340174 GGAACTCATCCATTTCTTGTAGG - Intergenic
1135862993 16:26074392-26074414 GGTAAGCATACATTTATTGGGGG + Intronic
1136507186 16:30712209-30712231 GGAAATGAGGCATTTGTTGTGGG - Intronic
1136659710 16:31746778-31746800 TGAAGTCACGTATTTCTTGGAGG + Intronic
1139287302 16:65827081-65827103 GGTAATCCTGAATTTGTTGGGGG - Intergenic
1140997542 16:80276119-80276141 GGGAATCATGGATTTCTAAGTGG - Intergenic
1141295550 16:82765100-82765122 TTAAATCATTCATTTCTTTGTGG + Intronic
1144041681 17:11417292-11417314 CGGAATCAACCATTTCTTGGTGG - Intronic
1144058564 17:11561622-11561644 GGAAATCAGGAGTTTCTGGGAGG - Exonic
1144188796 17:12824099-12824121 GGAAATAATGGATTTCCTCGTGG + Intronic
1146441983 17:32905194-32905216 GGAAATCTTGCCTTCCTTGTTGG + Intergenic
1147499803 17:40951858-40951880 AGAAATAATGCTTGTCTTGGAGG - Intergenic
1148454871 17:47805819-47805841 GGAAGTCATGCTTTCTTTGGGGG - Intergenic
1149205541 17:54241315-54241337 GAAAATCATCCATTTCATGCAGG + Intergenic
1149284130 17:55143267-55143289 TTTAATCATGCATTTCTTTGGGG - Intronic
1150133874 17:62684170-62684192 TCAAAACATGCATTTCATGGTGG + Intronic
1150622063 17:66814952-66814974 AGAAATCACTGATTTCTTGGGGG + Intergenic
1154371651 18:13768800-13768822 GGAATTTATCCATTTCTTGTAGG - Intergenic
1154392860 18:13956639-13956661 GGAATTTATACATTTCTTGTAGG - Intergenic
1155418142 18:25623585-25623607 GGAATTTATCCATTTCTTGTAGG + Intergenic
1155561656 18:27084392-27084414 GGAATTTATTCATTTCTTGTAGG + Intronic
1156805664 18:41176813-41176835 GGAATTTATGCATTTCTTTTAGG + Intergenic
1157398857 18:47369064-47369086 TGAACTCATGCAGTTCTAGGTGG + Intergenic
1159398749 18:67901742-67901764 GGAAACCATCCATGTCTTTGAGG - Intergenic
1160244987 18:77150776-77150798 CCAAATTATTCATTTCTTGGAGG + Intergenic
1161556538 19:4945829-4945851 GGACACCATGTATATCTTGGTGG + Intronic
1161678091 19:5664304-5664326 GGAAATTATGCTTTTCATTGGGG + Intronic
1164838248 19:31372696-31372718 CCAAGTCATACATTTCTTGGGGG + Intergenic
1166176189 19:41072670-41072692 GGAATTCATTCATTTCTTCTAGG + Intergenic
1167579950 19:50335347-50335369 GGAAATGGTGCTTTTCTTGATGG + Intronic
1168496782 19:56859268-56859290 GAAAATTATGCATTTCTTTAAGG - Intergenic
925393437 2:3515272-3515294 GGAAGGAATGCATTTCTGGGGGG + Intronic
925853822 2:8110290-8110312 GGAAATCAAGCAATACTTAGAGG - Intergenic
927118093 2:19924779-19924801 GGAAATACTCCATTTCCTGGAGG + Intronic
927265353 2:21141680-21141702 GGAATCCATGCTTTTCTTAGTGG + Exonic
928422082 2:31145457-31145479 AGAAATAATGCATCTCTTTGGGG + Intronic
928727133 2:34187385-34187407 GGAAAACATGGATACCTTGGAGG + Intergenic
928757018 2:34538830-34538852 GGAATTCATCCATTTCTTCTAGG + Intergenic
929255512 2:39807076-39807098 GGAATTAATCCATTTCTTGTAGG + Intergenic
929908601 2:46068938-46068960 GGAAATCCTGCATTTCTAAGAGG - Intronic
930257648 2:49110432-49110454 GTAAATCATTTATTTCTAGGTGG + Intronic
930415893 2:51091006-51091028 TGAAAACATACATTTCTTGTGGG - Intergenic
930494756 2:52127010-52127032 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
930546231 2:52770888-52770910 GGAATTCATCCATTTCTTCTAGG - Intergenic
930690873 2:54362873-54362895 GGAATTCTTGCATTACTTAGTGG - Intronic
930928981 2:56857816-56857838 GGAATTCATCCATTTCTTCTAGG + Intergenic
931535785 2:63274700-63274722 GGAACTTATGCATTTCCTGTAGG - Intronic
931576943 2:63727796-63727818 GGAAATTATGCATTTCTTCTAGG + Intronic
932069373 2:68602098-68602120 GGAAATTATTCATTTCTTCTAGG - Intronic
932845357 2:75129661-75129683 GAAAATGATGCATTTTTTGGAGG + Intronic
934108867 2:88723413-88723435 GGAAATCTTGCATTCCTTGTTGG + Intronic
934948942 2:98563222-98563244 GGAGACCAGGCATGTCTTGGAGG + Intronic
935152813 2:100453383-100453405 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
935965582 2:108471147-108471169 GGAAATTATCCATTTCTTCATGG - Exonic
936477221 2:112849799-112849821 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
937069895 2:119055106-119055128 GGAAGGAATGCATTCCTTGGGGG - Intergenic
937338119 2:121074560-121074582 GGAGATGATGGATTTCCTGGAGG - Intergenic
937728167 2:125191879-125191901 GGAATTCATGCATCTCTTCTAGG + Intergenic
938136524 2:128762951-128762973 GGAAATTATCCATTTCTTCTAGG + Intergenic
938483158 2:131679024-131679046 GAAAATCAAGCATTTCTAAGAGG - Intergenic
938737422 2:134199032-134199054 GGAAATGCAGCATTTCCTGGTGG - Intronic
939065415 2:137478592-137478614 AGAATTATTGCATTTCTTGGAGG + Intronic
940557961 2:155256528-155256550 GGACTTCATGCATTTCTTTTTGG + Intergenic
941940920 2:171036391-171036413 AGAAATTATGCTTTTTTTGGGGG - Intronic
942423235 2:175830366-175830388 GGAAACTGTGCATGTCTTGGAGG + Intergenic
942912006 2:181255145-181255167 GGAAAGCAAGCATTGTTTGGTGG - Intergenic
943778235 2:191791856-191791878 GGACATCCGACATTTCTTGGTGG - Intergenic
944297305 2:198080929-198080951 GTAAAACATGTATTTCTTGAAGG + Intronic
944431972 2:199644040-199644062 GTAAATCAGGGATTTCTTCGTGG + Intergenic
945549268 2:211199034-211199056 GCACTCCATGCATTTCTTGGAGG + Intergenic
945789738 2:214290164-214290186 GGAATTCATCCATTTCTTCTAGG + Intronic
946522465 2:220481615-220481637 CGAAATCATGCATATCTCAGAGG + Intergenic
947287431 2:228532090-228532112 GGAAATCATGTCTTCCTTGTTGG - Intergenic
948296452 2:236864224-236864246 GGAAATCATGCATCCATTGAGGG + Intergenic
948353654 2:237360489-237360511 GGGAATCAAGCATCACTTGGAGG - Intronic
949029614 2:241786668-241786690 GGAGATCAGGGATTTTTTGGAGG + Intronic
1168968950 20:1917747-1917769 GGAGATGAGGCATTTCCTGGTGG + Intronic
1170561323 20:17561101-17561123 GGAAATCAAGCATTTTTTTAAGG - Intronic
1170708890 20:18771266-18771288 GGAATTCATCCATTTCTTACAGG + Intergenic
1170749043 20:19128839-19128861 GGAAATTATCCATTTCTTCTAGG + Intergenic
1171126233 20:22604045-22604067 GGACATTAAGCATTTCCTGGAGG + Intergenic
1171157155 20:22886118-22886140 GGAATTTATCCATTTCTTGTAGG + Intergenic
1173574470 20:44102847-44102869 GGAAGTCATCCATTTCTTCTAGG + Intergenic
1175548256 20:59794783-59794805 GGAAATGATCCATTTCTTCTAGG + Intronic
1177314975 21:19448090-19448112 GGAATTTATGCATTTCTTCTAGG - Intergenic
1177579925 21:23008189-23008211 GGAGACCATGCATTTCTTTCAGG - Intergenic
1177970702 21:27786073-27786095 ATAAATCATACATTTATTGGTGG + Intergenic
1178828609 21:36035888-36035910 AGAAATCCTGCATGTCCTGGGGG + Exonic
1180484239 22:15781487-15781509 GAAAATCAAGCATTTCTAAGAGG - Intergenic
1181391958 22:22589587-22589609 GGAAATCATCAATTTCTAGCTGG + Intergenic
1182032562 22:27171002-27171024 GGAAATCCTGCATTTCTAACGGG - Intergenic
1182164796 22:28162349-28162371 GGAAAAAATGCATTTCCTGTGGG + Intronic
1182710516 22:32319987-32320009 GAAATTGATCCATTTCTTGGAGG - Intergenic
1182986045 22:34717895-34717917 GGAATTCATCCATTTCTTCTAGG - Intergenic
1183295425 22:37026585-37026607 GGGAAACATGCTTTGCTTGGTGG + Intronic
1184125272 22:42482383-42482405 GGTAGCCATGAATTTCTTGGGGG + Intergenic
1184133757 22:42533843-42533865 GGTAGCCATGAATTTCTTGGGGG + Intergenic
1184398070 22:44256832-44256854 GAAATTGATCCATTTCTTGGAGG - Intronic
949912071 3:8919747-8919769 TGAAATCAGCCATTTCTTTGAGG - Intronic
950344646 3:12281870-12281892 GGAACTCATGATTTTCTTGGAGG - Intergenic
951164085 3:19463623-19463645 GGAACTTATGCAGTTATTGGTGG + Intronic
951197408 3:19839862-19839884 GGAATTCATCCATTTCTTCTAGG - Intergenic
951297846 3:20961100-20961122 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
951568124 3:24033011-24033033 GGAATTTATGCATTTCTTCTAGG + Intergenic
952293800 3:32043161-32043183 GGAAGGAATGCATTCCTTGGGGG - Intronic
953395924 3:42569823-42569845 GGAAAGGATGCCTCTCTTGGTGG + Intronic
953731450 3:45452914-45452936 GGAATTCATCCATTTCTTCTAGG + Intronic
956298559 3:67742395-67742417 GGAATTTATACATTTCTTGCAGG + Intergenic
956550697 3:70455607-70455629 GGAAATTATCCATTTCTTCTAGG - Intergenic
957472506 3:80677626-80677648 GGAAATCATCCTTTAATTGGTGG - Intergenic
957903466 3:86528498-86528520 GGAATTCATCCATTTCTTCTAGG - Intergenic
958954305 3:100450842-100450864 GGAAATCTTGCCTTCCTTGTTGG + Intronic
959205696 3:103303850-103303872 TGAAATCCCGTATTTCTTGGAGG + Intergenic
959436820 3:106325509-106325531 GGACATCATGGATATCTTTGGGG + Intergenic
959722196 3:109504869-109504891 GTAAATCATGGATTTCTTCTTGG + Intergenic
960346719 3:116541972-116541994 GGAATTTATTCATTTCTTGTAGG - Intronic
960608640 3:119533902-119533924 GCAAATAATGCATTTATAGGAGG - Intronic
963013647 3:140800005-140800027 GGAATTCATCCATTTCTTCAAGG + Intergenic
964611742 3:158622752-158622774 GGAAATCTTGCCTTCCTTGTTGG + Intergenic
965024383 3:163281626-163281648 GGAATTCATCCATTTCTTCTAGG - Intergenic
966031266 3:175350675-175350697 AGAAATCATGAATTTTTTGTAGG + Intronic
966081595 3:176010578-176010600 GGTGCTCATGCATTTCATGGTGG + Intergenic
966111380 3:176406007-176406029 TGAAATCAGTCATTTCTTGTAGG + Intergenic
968294240 3:197561372-197561394 GGAAATCTTGCCTTCCTTGTTGG - Intronic
969718106 4:8878023-8878045 GGAAATCCTGCATTGAATGGAGG - Intergenic
969727117 4:8926774-8926796 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
970133877 4:12900768-12900790 GGAAAGCATACATTTCTTCAAGG - Intergenic
970941938 4:21644408-21644430 GGAAGTGATGCATATCTTGAGGG + Intronic
971183009 4:24348807-24348829 GGAAATCAGGGATTTCTTCTTGG + Intergenic
972237956 4:37156122-37156144 GGAAATCAAGCATTTTTAGCTGG - Intergenic
972915400 4:43871096-43871118 GGAAATTATTCATTTCTTCTAGG + Intergenic
973060938 4:45723454-45723476 GGAATTCATCCATTTCTTCTAGG - Intergenic
974948098 4:68552871-68552893 GGAAATATTGCCTTTCTTGTAGG - Intronic
974957165 4:68656136-68656158 GGAAATCTTGCCTTTCTTGTAGG - Intronic
976992597 4:91386149-91386171 TGTAATCAGCCATTTCTTGGTGG - Intronic
977241565 4:94576443-94576465 GGAAATCATGAATTTGTAAGGGG + Intronic
978570625 4:110132973-110132995 GGAAGTCATCCATGTCTGGGTGG + Intronic
978734770 4:112073308-112073330 GGAAGGAATGCATTCCTTGGGGG + Intergenic
980087102 4:128403103-128403125 GTAAATCATGGATTTCTTCTTGG + Intergenic
980270203 4:130574469-130574491 GGAAATCTTGCCTTTCTTATTGG + Intergenic
981015876 4:139973895-139973917 AGAAATTTTGCCTTTCTTGGAGG - Intronic
982732260 4:158968821-158968843 TGAAATCTTGAATTTCTTGATGG - Intronic
983508636 4:168583906-168583928 GGAAACTATGCCTTTCTTGGTGG - Intronic
984422853 4:179547348-179547370 GGAATTCATCCATTTCTTCTAGG - Intergenic
986862042 5:11937868-11937890 GGAAATCATTAATTTCTTCCAGG - Intergenic
988716950 5:33837517-33837539 GAAAATCCTTCATTTCTTGCAGG + Intronic
991923983 5:71685067-71685089 GGAAATCAGGAATTTCTTCTTGG - Intergenic
992260583 5:74966306-74966328 GGAATTCATGAAATTCTTGAAGG - Intergenic
992965888 5:81999781-81999803 GGAATTTATCCATTTCTTGCAGG - Intronic
994151590 5:96453999-96454021 GGAAATTATGCAGGTCTTGAAGG - Intergenic
994573092 5:101538566-101538588 CGTAATCACGTATTTCTTGGAGG - Intergenic
994909156 5:105879812-105879834 GGAATTCATGCATTTATGTGTGG - Intergenic
996027306 5:118660989-118661011 GGAACTTATGCATTTCTTCTAGG + Intergenic
996141897 5:119921402-119921424 GGAAATTATCCATTTCTTCCAGG + Intergenic
996195765 5:120605210-120605232 GATAATCCTGTATTTCTTGGAGG + Intronic
996264671 5:121523765-121523787 GGAATTCATCCATTTCTTCTAGG - Intergenic
996619014 5:125477754-125477776 GGAAATCCTCCATTGCCTGGAGG - Intergenic
996850235 5:127943377-127943399 GGAAATCATGGATTTGGGGGAGG - Intergenic
997958293 5:138297885-138297907 GAAAATCATGCATTGCCTTGGGG + Intronic
998511540 5:142718381-142718403 GGCAACCCTGCATTTCATGGAGG - Intergenic
999033650 5:148321774-148321796 GGAAACAATGCTTTTCTTTGTGG - Intronic
999049279 5:148504889-148504911 GGAATTTATCCATTTCTTGTAGG - Intronic
999066341 5:148690366-148690388 GGAATTCATCCATTTCCTGTAGG - Intergenic
999521538 5:152355870-152355892 GCAAAGCATGAATTTATTGGAGG - Intergenic
1003520945 6:6857636-6857658 GGAAAACTTGCATTTCTTACAGG + Intergenic
1003773480 6:9334371-9334393 GTAAATAATGCAGTTCTGGGAGG - Intergenic
1003987414 6:11451053-11451075 GGGAATCATTTATTTCTTTGAGG + Intergenic
1004058914 6:12171346-12171368 TGAAATCATGGATTTCTGGCTGG - Intergenic
1004217218 6:13713749-13713771 TGAAATCATTAATTTCTTGATGG - Intergenic
1007022397 6:38534264-38534286 GGGAATGATGCATTTCTTCTAGG - Intronic
1007434669 6:41800717-41800739 GGAAATAATGCATATCTTTCAGG + Intronic
1008785770 6:55165709-55165731 GGAAATCATGTATTTGTTAAGGG + Intronic
1008928951 6:56916936-56916958 GGCAAGCATCCATTTCATGGGGG - Intronic
1010514523 6:76757317-76757339 GGAATTTATCCATTTCTTGTAGG - Intergenic
1010557672 6:77304547-77304569 GGAATTTATGCATTTCTTCTAGG + Intergenic
1010681492 6:78804339-78804361 GGAATTCATCCATTTCTTCTAGG + Intergenic
1011451124 6:87493283-87493305 TGAAATCATACATTTCTTCAAGG + Intronic
1011684259 6:89811788-89811810 GGAAATCCTGCCTTTCTTCTTGG + Intronic
1013500263 6:110742615-110742637 GGAAAGAATGCATTCCTGGGGGG + Intronic
1013571678 6:111433458-111433480 GGAAATTATCCATTTCTTCTAGG - Intronic
1013920965 6:115402915-115402937 GGAAGGAATGCATTCCTTGGGGG - Intergenic
1014317054 6:119881080-119881102 GGACATGATGCATTTCTTTTAGG + Intergenic
1014664851 6:124224442-124224464 GGAAATCATCTAATTCTTAGAGG - Intronic
1015188986 6:130452507-130452529 GAAAATCATGGAAATCTTGGAGG - Intergenic
1015500914 6:133932172-133932194 CGTAATCCTGTATTTCTTGGAGG - Intergenic
1016477548 6:144444200-144444222 GGAAATCATGAATTTCTTCAAGG + Intronic
1016540939 6:145163493-145163515 TGATATCATTCATTTCTTTGTGG + Intergenic
1016793613 6:148093819-148093841 GGAATTCATTCATTTCTTCTAGG - Intergenic
1017242971 6:152191520-152191542 GGAAATCATCCATTTCTTCTAGG + Intronic
1018009515 6:159656412-159656434 GTAAATCATGGATTTCTTCTTGG - Intergenic
1018665744 6:166135792-166135814 GTAAATCAGGCATTTCTTCTTGG - Intergenic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1019761264 7:2814603-2814625 GGAAATAAGGAATTTTTTGGTGG - Intronic
1020620423 7:10511123-10511145 GGAATTCATCCATTTCTTCTAGG + Intergenic
1020768869 7:12361728-12361750 ATGAATCATGCATTTCTTGGCGG + Intronic
1021147524 7:17107107-17107129 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
1021487886 7:21187222-21187244 GGATATCATGCCTGTCTTTGGGG - Intergenic
1022811762 7:33875669-33875691 GGAAATAATGCCTTTCTAAGTGG - Intergenic
1023100103 7:36709027-36709049 GGAAACCATGCATGTGTCGGGGG - Intronic
1023548141 7:41340532-41340554 GCAAATCATACATTTATGGGAGG - Intergenic
1023774682 7:43593757-43593779 GGATATCATCCCTTTGTTGGAGG + Intronic
1024090623 7:45937132-45937154 TGAAATCATGAACTTCTAGGAGG - Intergenic
1026049878 7:66936704-66936726 GGAATTCATCCATTTCTTCTAGG + Intronic
1027777580 7:82485779-82485801 GCAAAAAATGAATTTCTTGGAGG + Intergenic
1027991381 7:85366320-85366342 GGAAATTATTCATTTCTTCTAGG + Intergenic
1028266240 7:88729534-88729556 GGAAATTATCCATTTCTTCTAGG + Intergenic
1030260616 7:107560562-107560584 GTAAATTATGAATTCCTTGGAGG - Intronic
1030419925 7:109295942-109295964 GGATATAATTCATTTATTGGTGG - Intergenic
1030513494 7:110514344-110514366 GGAATTTATCCATTTCTTGTGGG + Intergenic
1031304552 7:120110228-120110250 GGAAGGAATGCATTACTTGGGGG + Intergenic
1032310067 7:130777833-130777855 GGAATTCATCCATTTCTTCTAGG + Intergenic
1032642498 7:133785591-133785613 GGAAATAATGGCATTCTTGGGGG - Intronic
1036546703 8:9777694-9777716 GGGAAGCATGTATTTTTTGGAGG - Exonic
1036858830 8:12327083-12327105 GGAATTTATGCATTTCTTCTAGG - Intergenic
1037231864 8:16668861-16668883 ATAATTCATGTATTTCTTGGTGG - Intergenic
1037979414 8:23240321-23240343 GGAAAACTTGCCTTTCTTGTTGG - Intergenic
1038706871 8:29902522-29902544 TGAAGTCCTGTATTTCTTGGAGG - Intergenic
1039024104 8:33239011-33239033 GAAGATCTTGCCTTTCTTGGTGG - Intergenic
1039598431 8:38811954-38811976 GGAAAGAATGCATTCCTGGGGGG + Intronic
1039667374 8:39548550-39548572 GGAATTCATTCATTTCTTCTGGG + Intergenic
1040088349 8:43368438-43368460 GGAAAACTTGCATTCCTTGTTGG - Intergenic
1041833439 8:62183035-62183057 GGATATTAAGCATTTCTTTGAGG + Intergenic
1041877873 8:62711739-62711761 GTAAATCATGCATTTCTTCTTGG + Intronic
1042197955 8:66249617-66249639 GGAAAGAATGCATTCCTTGGGGG + Intergenic
1043426785 8:80155943-80155965 GGAGATGATGCATTTGTTTGGGG + Intronic
1044670142 8:94671596-94671618 GGACATCCTGGATTTCCTGGGGG + Exonic
1045765690 8:105665202-105665224 GGAATTAATGCCTTTCTTGGGGG - Intronic
1046157658 8:110314157-110314179 GTAAAATATGCATTTCTAGGAGG + Intergenic
1046578051 8:116056562-116056584 GTAAATCATATAATTCTTGGAGG - Intergenic
1048235688 8:132687859-132687881 GAAAACCATGCAGTTCCTGGGGG - Intronic
1048849964 8:138635682-138635704 AGAAATCATTTGTTTCTTGGTGG - Intronic
1048983813 8:139719157-139719179 GAAAATCATCCATTTCCTTGAGG - Intergenic
1049282525 8:141757485-141757507 GGAACACATGCATTCCCTGGAGG - Intergenic
1049449405 8:142652066-142652088 GGAGATCAGGGATTTTTTGGAGG + Intergenic
1050006458 9:1136658-1136680 GGAATTTATCCATTTCTTGTAGG + Intergenic
1051240708 9:15052833-15052855 GGAATTTATCCATTTCTTGTAGG - Intergenic
1052551050 9:29949599-29949621 GGAATTTATCCATTTCTTGTAGG + Intergenic
1052890236 9:33692411-33692433 GGAAATTAAGCATCTCTTAGAGG - Intergenic
1055367797 9:75563832-75563854 GGAATTTATCCATTTCTTGTAGG + Intergenic
1056082716 9:83113603-83113625 GGAAGGAATGCATTCCTTGGGGG + Intergenic
1056210855 9:84363875-84363897 GGAAATCAGGCCAGTCTTGGTGG - Intergenic
1056769399 9:89465974-89465996 GTGACTCCTGCATTTCTTGGAGG + Intronic
1057296097 9:93842393-93842415 GGAAATTATCCATTTCTTCTAGG + Intergenic
1057467806 9:95331607-95331629 GGAAATCTTGCCTTCCTTGTTGG + Intergenic
1057910199 9:99014367-99014389 GGAAAACTTGCATTCCTTGTTGG + Intronic
1057940515 9:99278771-99278793 GGAAATGATGAATTTATAGGTGG + Intergenic
1058225447 9:102356117-102356139 GGAAGGAATGCATTCCTTGGGGG + Intergenic
1058383823 9:104409636-104409658 GGAAATCTTGCCTTCCTTGTTGG - Intergenic
1058996939 9:110308235-110308257 GGAAATCTTGCCTTCCTTGTTGG - Intronic
1186906767 X:14119316-14119338 GGAAATAATAGATTTCTTTGGGG + Intergenic
1187782902 X:22848763-22848785 GAAAATCTTACATTTCTTAGTGG + Intergenic
1188979711 X:36716121-36716143 TGTACTCATGCACTTCTTGGTGG - Intergenic
1189215823 X:39322356-39322378 GAAAATTAAGCATTTCTGGGTGG - Intergenic
1189653402 X:43214471-43214493 GGAATTTATTCATTTCTTGTAGG - Intergenic
1189659572 X:43282577-43282599 GGAATTTATCCATTTCTTGTAGG + Intergenic
1191004562 X:55697281-55697303 GGAACTCATGAGGTTCTTGGTGG + Intergenic
1191647549 X:63498335-63498357 GGAATTCATCCATTTCTTCTGGG - Intergenic
1192440968 X:71173366-71173388 TGAAATCATGCCTGTCTTGGAGG - Intergenic
1192797232 X:74434154-74434176 GGGAATCATACACTTCTTGAGGG - Intronic
1192921125 X:75707572-75707594 GGAAGGAATGCATTCCTTGGGGG + Intergenic
1193253288 X:79318808-79318830 GTAAATCATGAATTTCTTCTTGG + Intergenic
1193423659 X:81315471-81315493 GGAAATCAGGGATTTCTTCATGG + Intergenic
1193441385 X:81543770-81543792 GGAAGGAATGCATTCCTTGGGGG + Intergenic
1193973539 X:88088216-88088238 GAAATTCATGCATTTCTTCTAGG + Intergenic
1194042258 X:88956211-88956233 GGAAAGAATGCATTCCTGGGGGG + Intergenic
1194273137 X:91845414-91845436 GAAAATGATGCATTTGATGGGGG - Intronic
1194436432 X:93873526-93873548 GCCCATCAGGCATTTCTTGGGGG + Intergenic
1194515038 X:94841955-94841977 GGAATTTATCCATTTCTTGTAGG + Intergenic
1194604670 X:95964078-95964100 GGATATCAGGCATTTCTAGCTGG + Intergenic
1194904312 X:99554734-99554756 GGAATTCATCCATTTCTTCTAGG + Intergenic
1194989598 X:100532507-100532529 GGAAATTATCCATTTCTTCTAGG + Intergenic
1195487257 X:105423837-105423859 GGAAATCTTGCCTTCCTTGTTGG + Intronic
1197141771 X:123125127-123125149 GGAATGCATGCATTTCTTCTAGG - Intergenic
1197308250 X:124870567-124870589 TGAAAACATGCAATACTTGGAGG + Intronic
1197512190 X:127383334-127383356 GGAATTCATCCATTTCTTCTGGG + Intergenic
1198727555 X:139692647-139692669 GCAACTCATGCAAGTCTTGGCGG + Intronic
1198842029 X:140867478-140867500 GGAATTTATCCATTTCTTGACGG - Intergenic
1199906225 X:152234362-152234384 GGATATCATTTATTTGTTGGAGG + Intronic
1200203418 X:154298100-154298122 GGAATTTATCCATTTCTTGTAGG + Intronic
1200590379 Y:5066812-5066834 GAAAATGATGCATTTGATGGGGG - Intronic
1202168859 Y:22019904-22019926 GAATATTATGCATTTCTTGTTGG + Intergenic
1202222502 Y:22566464-22566486 GAATATTATGCATTTCTTGTTGG - Intergenic
1202320613 Y:23629196-23629218 GAATATTATGCATTTCTTGTTGG + Intergenic
1202550154 Y:26040860-26040882 GAATATTATGCATTTCTTGTTGG - Intergenic