ID: 1072352856

View in Genome Browser
Species Human (GRCh38)
Location 10:94575377-94575399
Sequence ACGTGAGCCACTGTACCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072352852_1072352856 10 Left 1072352852 10:94575344-94575366 CCACTTTGGCCTCTCAAAGTACT 0: 6
1: 359
2: 8257
3: 76287
4: 163725
Right 1072352856 10:94575377-94575399 ACGTGAGCCACTGTACCTCCCGG No data
1072352855_1072352856 1 Left 1072352855 10:94575353-94575375 CCTCTCAAAGTACTGGGATTATA 0: 66
1: 2821
2: 51803
3: 354903
4: 250473
Right 1072352856 10:94575377-94575399 ACGTGAGCCACTGTACCTCCCGG No data
1072352851_1072352856 11 Left 1072352851 10:94575343-94575365 CCCACTTTGGCCTCTCAAAGTAC 0: 9
1: 246
2: 5346
3: 49694
4: 160612
Right 1072352856 10:94575377-94575399 ACGTGAGCCACTGTACCTCCCGG No data
1072352848_1072352856 30 Left 1072352848 10:94575324-94575346 CCTGGCCTGAAGAGATCTGCCCA 0: 2
1: 48
2: 1996
3: 11709
4: 41792
Right 1072352856 10:94575377-94575399 ACGTGAGCCACTGTACCTCCCGG No data
1072352849_1072352856 25 Left 1072352849 10:94575329-94575351 CCTGAAGAGATCTGCCCACTTTG 0: 1
1: 5
2: 247
3: 3256
4: 13146
Right 1072352856 10:94575377-94575399 ACGTGAGCCACTGTACCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072352856 Original CRISPR ACGTGAGCCACTGTACCTCC CGG Intronic
No off target data available for this crispr