ID: 1072360467

View in Genome Browser
Species Human (GRCh38)
Location 10:94654141-94654163
Sequence AATTGTCTACAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1072360467_1072360473 25 Left 1072360467 10:94654141-94654163 CCTGCCATCTTCTGTAGACAATT No data
Right 1072360473 10:94654189-94654211 GGACTGTTACTCGGCTTTGGTGG No data
1072360467_1072360471 16 Left 1072360467 10:94654141-94654163 CCTGCCATCTTCTGTAGACAATT No data
Right 1072360471 10:94654180-94654202 ACAGCTCTTGGACTGTTACTCGG No data
1072360467_1072360472 22 Left 1072360467 10:94654141-94654163 CCTGCCATCTTCTGTAGACAATT No data
Right 1072360472 10:94654186-94654208 CTTGGACTGTTACTCGGCTTTGG No data
1072360467_1072360469 4 Left 1072360467 10:94654141-94654163 CCTGCCATCTTCTGTAGACAATT No data
Right 1072360469 10:94654168-94654190 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1072360467 Original CRISPR AATTGTCTACAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr